The Theme of Catcher in the Rye by J.D. Salinger Essay

The Theme of Catcher in the Rye by J.D. Salinger In the novel Catcher in the Rye by J.D. Salinger, the protagonist Holden Caulifield views the world as an evil corrupt place where there is no peace. Holden has a phony phobia that restricts him from becoming a fully matured adult. In Holdens attempted journey in becoming a fully matured adult, he encounters many scenarios involving friendship, personal opinions, and his love of children. His journey is an unpleasant and difficult one with many lessons learned along the way; including the realization that he is powerless to change the world. Around every corner Holden sees corruption. He looks out on a world, which appears completely immoral and unscrupulous. Holden finds a hard†¦show more content†¦Holden believes that he can change the world and he reveals his feelings on a date with Sally Did you ever get fed up? #8230; I mean did you ever get scared that everything was going to go lousy unless you did something#8230;(pg 130). Holden proposes to Sally to escape this world with him. It is finally to his younger sister that Holden reveals that he wants to prevent children from growing up. He blames the worlds corruption on adults and believes that when he stops the children from growing up he will preserve their innocence and save the world. Holdens phony addiction gets him into trouble at school. Holden looks for the flaws in everyone and tries to eliminate that person he sees as a threat, such as when Holden decides to face off against the phony Stradlater after Stradlaters date with Jane. Holden also thinks every teacher is a phony who pretends to be helpful to students. If Holden has trouble in school he does not seek help from his peers because he believes that they are phonies. Hence this point is tied into one of the reasons he is kicked out of Pencey, failing four out of five courses. Holdens avoidance of things phony is very strong and he has a one-track mind. It is either his way or the highway, this is another example of how Holdens phony problem hinders his chance at full maturity. Holden is so scaredShow MoreRelatedHolden Caulfield and the Pressures of Society: The Catcher in the Rye by J.D. Salinger1286 Words   |  6 Pagesmessage or theme for the reader. Not only do authors use themes, but also well d eveloped characters to bring a novel to life. In the bildungsroman, The Catcher in the Rye by J.D. Salinger, characterization is often found, especially regarding the protagonist, Holden Caulfield. Salinger also includes many themes in his novel relating to growing up in a corrupt society. Hence, this paper will compare, contrast, and evaluate literary criticisms regarding the themes and characterization of J.D. Salinger’sRead MoreThe Importance of Censoring in The Catcher in the Rye by J.D. Salinger1145 Words   |  5 PagesJ.D. Salinger was an American author well known for his best seller The Catcher in the Rye, a considerably influential novel that portrayed the feelings of alienation that were experienced by adolescents in North America after World War II (J.D. Salinger Biography). Salinger’s work appeared in many magazines, including a series of short stories which inspired many new authors (J.D. Salinger Biography). His inspiration for Pencey Prep boarding school in The Catcher in the Rye stemmed from hisRead MoreCatcher in the Rye vs Frankenstein Novel Study Essay1304 Words   |  6 PagesIndependent Novel Study In today’s world, innocence cannot be preserved forever. As humans age, they lose their innocence due to the corruption that exists in society. This is demonstrated in the two novels, Catcher in the Rye and Frankenstein. The two authors, J.D. Salinger and Mary Shelley prove this statement through their use of various literary devices. Key characters in both novels- Holden and the creature- learn through personal experiences that innocence cannot, in fact, be preserved foreverRead MoreAnalysis Of Characters And Themes Of The Catcher Rye 1537 Words   |  7 Pages Analysis of Characters and Themes in The Catcher in the Rye J.D. Salinger was born in 1919 to a wealthy Manhattan family. He grew up in the same social conditions as Holden Caulfield does in The Catcher in the Rye. The last thing Salinger cared about was being a successful student because he was very lazy, without care for his responsibilities and tasks. Salinger flunked out of many prep schools, and his parents sent him to a military academy named Valley Forge in Pennsylvania, where he graduatedRead MoreTheme Of The Catcher In The Rye976 Words   |  4 PagesThroughout the novel The Catcher in the Rye by J.D. Salinger there are several different themes portrayed that widely relate to current issues of teenagers and adults alike. While reading the novel several different themes were revealed creating a deep and meaningful story line. Three themes viewed within the novel are; the phoniness of the adult world, alienation as a form of self-protection, and the painfulness of growing up. Each of these themes have large significance in character a nd plot developmentRead More Comparing A Separate Peace and The Catcher in the Rye Essay example1500 Words   |  6 PagesPeace and The Catcher in the Rye The coming of age novels, The Catcher in the Rye, written by J.D. Salinger, and A Separate Peace, written by John Knowles, both interpret the lives of adolescent boys journeying through their conflicts and inner confusion to reach the level of maturity. Salinger and Knowles both discern the literal ways a typical teenager grows up with the help of literary elements such as plot, setting, character development, conflicts, irony, symobolism, theme, and point ofRead MoreF. Salinger s The Catcher s The Rye 1614 Words   |  7 Pagesshelves, also the best novel read in class. The Catcher in the Rye is a novel commonly found on psychopaths’ shelves and no one has ever found out why. It is a remarkable novel that has been banned in the past but is also studied today in schools around the world. In Mr. Capilongo’s grade 9 AP English class, three novels were read following the theme of â€Å"The teen experience†: To Kill a Mockingbird, by Harper Lee, The Catcher in the Rye by J.D. Salinger, and The Chrysalids, by John Wyndham. The classRead MoreCatcher in the Rye Abstract Essay1364 Words   |  6 PagesOctober 2012 Novel Abstract: Catcher in the Rye Novel Title and Author: Catcher in the Rye by J.D. Salinger Author’s Background: J.D. Salinger was born on January 1, 1919, in New York City, New York. Jerome David Salinger was born to Sol Salinger and his wife Miriam (J.D. Salinger). Though he was a bright young man, when he attended McBurney School, he ended up flunking out and was soon after sent to Valley Forge Military Academy in Wayne, Pennsylvania (J.D. Salinger). After graduating Valley ForgeRead MoreHow Salinger’s Holden Caulfield Relates to Teenagers Throughout Time1412 Words   |  6 PagesSalinger’s Holden Caulfield Relates to Teenagers Throughout Time In 1951, J.D. Salinger’s The Catcher in the Rye was #1 on the New York Time’s bestseller list. Since then, the American Literary Association claims The Catcher in the Rye is a â€Å"favorite of censors.† The use of harsh language and profanity has been a long time debate of educators causing the novel to be pulled off bookshelves and propelling J.D. Salinger and his protagonist, Holden Caulfield, into reluctant fame. The translationRead MoreAlienation and Isolation in The Catcher in the Rye by J.D. Salinger700 Words   |  3 PagesTouch with Society In The Catcher in the Rye, J.D. Salinger discusses the ideas of alienation and isolation. He notes that if one is unable to keep up with society they lose touch. Salinger portrays alienation and isolation through literary devices such as symbolism. Some of the symbolic features use in the novel is Holden’s red hunting hat which shows Holden’s uncommon desire compared to society’s desires. Another significant symbolic feature is the catcher in the rye; this represents Holden’s idea

Problems Facing Non Elderly Americans Essay - 765 Words

Ahmed, Lemkau, Nealeigh, Mann (2001), focused their study on problems facing non-elderly Americans attempting to access health care. In particular, their research shows that there is a correlation between greater access to care and better health status, along with reduced hospitalization rates. This is strong testimony for the need to remove barriers to care. Barriers encountered in this study were lack of telephone, transportation issues, and difficulty taking time off work to obtain care to name a few. Ahmed et al. (2001) conducted door to door interviews using questions that were developed by a local cohort group that understood the demographics and needs of the local community. The survey area was stratified using U.S. Census bureau data identifying areas of poverty within the city. From these areas, randomized blocks were chosen for sampling with the survey. As a result, door to door, face to face survey interview was chosen due to the fact that 20% of impoverished families do not have telephones (Ahmed et al., 2001). Further, interviewers were instructed to walk down each block and attempt to interview a non-elderly individual in every 10th dwelling. In this case, definition of a poor family was defined as 125% of the federal poverty level. Particular questions related to income were asked early in the survey so that if an individuals answer fell out of the intended group the survey could be wrapped up quickly and interviewers could move on to moreShow MoreRelatedPaper On Opioid Abuse759 Words   |  4 PagesOften, community members are unaware of serious issues facing their communities. It is crucial to raise awareness in the older population about opioid dependence and misuse. It is important to educate the audience about the far-reaching effects of this problem, tips on how to manage prescription medication using the File of Life program, ways to safeguard medication from theft, properly disposing unused or expired medication, identifying signs of drug addiction in a loved one and how to get themRead MoreEssay on Welfare Reform1022 Words   |  5 PagesChildren The major problem facing poor Women and Children after the adoption of Welfare Reform is, the lack of adequate healthcare for these families. The Women and Children facing this problem are mainly from out-of-wedlock families. It is believed that by removing such benefits it will end such problems like crime, young black men not feeling sense of accomplishment by not working and the bond of community relationships deteriorating. In trying to address this problem I have come up with twoRead MoreHigh Medical Bills Should Not Reduce The Cost Of Living Essay1161 Words   |  5 Pagesstays and nursing home admissions. In 2014, there were over 4,800 seniors in Scioto County, Ohio over the age of 65 living below the poverty line and facing the threat of hunger (Scioto County Commissioners, 2016). The Community Action Organization (CAO) of Scioto County is an agency that is striving to alleviate the issue of hunger among the elderly in the community by providing home delivered meals to individuals that are homebound through their CAO Senior Nutrition Program (Community Action OrganizationRead MoreHcs/440 Health Care Spending1584 Words   |  7 Pagesthe past decade United States has been facing a recession that has resulted in higher unemployment and lower income levels for many Americans. The United States present position has drawn attention to the health spending and affordability (The Henry J. Kaiser Family Foundation, n.d). Over the past 10 years employer-sponsored health coverage has increased by 97%, putting a burden employers and workers. Medicare provides coverage to the elderly and people with disabilities and MedicaidRead MorePolicy Analysis of the Older Americans Act of 1965 Essay1574 Words   |  7 PagesIndividuals included in the Act are American Indians, Native Alaskan Americans, Native Hawaiian Americans, tribal organizations, and persons with disabilities. The Act focuses on providing services to the individuals of this country who are in the greatest economic need. State and local government agencies, as well as nonprofit organizations and institutions are eligible according to the Act (Department, 2006) as long as they provide funds for older Americans. The Act also states that a tribal organizationRead MoreHome Health Care At Home Care1217 Words   |  5 PagesHome health care is a thankless job that has incomparable importance in how we care for patients. Often the home health care worker is filling a need to help elderly patients where their family is unable or unwilling to help. In effect, bringing the institution to the patient’s home. The relationship between the provider and the patient has the potential to bring about a dilemma in the respect for each party’s needs. So is true about the relationship between the Benson’s and the providers of A-1Read MoreU.s. Healthcare System : The United States1574 Words   |  7 PagesWhen it comes to the U.S. healthcare system, there are two sides of the argument. Some America ns may argue that the U.S. healthcare system is the best in the world given the many state-of-the-art healthcare facilities and innovative and advanced medical technology available, and there are those who argue that it is too costly and inefficient on many different levels (Chua, 2006). Despite the large amount of spending invested on their healthcare system, the U.S. consistently underperforms on mostRead MorePolicy Making and the Federal System Essay841 Words   |  4 Pagesin the Federal System Obama’s Care â€Å"Medicaid – not Medicare Frances Johnson POL: 201 American National Government Instructor, Carol Parker July 12th, 2012 During the 2008 federal campaign, Democratic presidential candidate Barack Obama placed comprehensive health care reform at the centre of his platform. In the light of the growing problems facing the US health care system, the time seemed ripe for another attempt to control health costs while expandingRead MoreHealth Care and the Reform Essay1082 Words   |  5 PagesHealth insurance was developed to provide guaranteed coverage for sickness, injury and preventable health measures. Currently, the United States is facing a major challenge in controlling the cost of health care and providing coverage for everyone. This is why it is so important for the government to develop a new health care insurance plan. The purpose of this paper is to explore the history of health care, the major improvements made to coverage through the years. Discussing the healthcare reformRead MoreThe Importance Of Effective Interpersonal Communication Skills1264 Words   |  6 PagesInterpersonal communicati on is a fundamental skill that nurses use every day to interact and communicate. These skills include clinical empathy towards patients, diverse cultural understanding, non-verbal communication and skills used to communicate with deaf patients. This paper will discuss why it is important for nurses to use effective interpersonal communication skills and tips to overcome elderspeak to help minimize patient complains within the healthcare practice. To create a healthy nurse

How African American Humor has Evolved and the Way We Look at Comedy Free Essays

string(81) " people watching the show the most funny and exciting part was the joke telling\." Professor Jim Gray of Sonoma State University defines culture as a means of survival. Going by this definition of culture the evolution of black humor has definitely been a foundation in the survival of the comedy in America. This paper will be a discussion of how African American Humor has evolved and for centuries has changed and continues to change the way we look at comedy. We will write a custom essay sample on How African American Humor has Evolved and the Way We Look at Comedy or any similar topic only for you Order Now Before beginning this paper, I must stress the importance of humor for all races. Truly, the environment in which most humor takes place has helped American culture and people survive. According to Constance Rourke, humor is important because: â€Å"1. Humor is a part of the natural life process and is commonly taken for granted or not recognized as having serious importance. The fact that humor is a framework for `non-real’ or `play’ activity and not taken as a `serious’ interaction allows messages and formulations to be `risked’ within its framework which would not otherwise be acceptable or possible. 3. Humor allows the exploration of new ideas in situations of uncertainty or unfamiliarity. Similarly allowed are the negotiation of taboo topics, sensitive issues, and marginal serious content. 4. Humor performs a boundary function on both internal and external lines, policing groups in terms of membership and acceptable and competence behavior. 5. Humor can function as a coping device to release tension, allay fear, forestall threat, defuse aggression or distance the unpleasant. 6. Humor can represent an implicit contradiction, paradox or `joke in the social structure’ made explicit. The `joke’ constitutes a reversal within its boundaries of the patterns of control in the real world. 7. `Canned’ jokes and `situational’ jokes are not entirely separate. Canned jokes are not sealed from the situation in which they are told as they always affect it and incorporate interaction into their pattern; situation jokes always have some impact beyond their context. Langston Hughes says, â€Å"Humor is laughing at what you haven’t got when you ought to have it. Of course, you laugh by proxy. You’re really laughing at the other guy lacks, not your own. That’s what makes it funny-The fact that you don’t know you are laughing at yourself. Humor is when the joke is on you but hits the other fellow first-Because it boomerangs. Humor is what you wish in your secret heart were not funny, but it is, and you must laugh. Humor is your unconscious therapy† (Hughes, 1966) Laughter for centuries has been the medicine that has helped to ensure the survival of African Americans. â€Å"Herded together with others with whom they shared only a common condition of servitude and some degree of cultural overlap, enslaved Africans were compelled to create a new language, a new religion, and a precarious new lifestyle. † (Joyner, 1984) As Africans were unloaded by boat and placed onto plantations, slave masters were completely enthralled by the way they spoke, moved, and danced. Out of slavery emerged a culture that would influence America’s mainstream culture for infinity. Slavery created bondage for Africans and when it looked like they were going nowhere fast; they laughed, sang, and amused one another with riddles, jokes and animal tales from the homeland. Slave masters could not conceive why slaves in such a miserable state were so joyous, what they did not know was many of the songs, jokes and riddles were more than surface deep and many times about the master. The slaves made the best of the circumstances through humor and by laughing at the way the slave master treated them and their reaction to this treatment. They were laughing at the slave master and at the same time laughing at themselves. However, it did not take long before slave masters made slave merry-making public. Many times slaves were called upon to entertain master and their guests. Slave merry-making was also encouraged because it also increased the price of the slaves. â€Å"People took notice to the way slaves spoke and moved, out of slavery evolved Blackface Humor. (Watkins, 1994) Blackface comedy was when a person (white) painted their face with black makeup and acted like a slave (Sambo). Blackface humor gave whites the chance to lift African American Humor from its original context, transform it, then spotlight it as their own entertainment, amusement (for non-black audiences) it became popular for it is supposed originality. As blackface entertainment became more popular so did the actors. George Washington Dixion introduced â€Å"Coal Black Rose† (Watkins) one song â€Å"Sambo and Cuffee†, (Watkins) was a comic song about a black woman and her lover. Dixion performed this act all over the world; some would argue that Dixion was the first white blackface performer to establish a broad reputation. By the 1830’s, blackface performers were everywhere becoming one of the most popular attractions of the American stage. Billy Whitlock, Frank Brower, Frank Pelham and Dan Emmett were also very popular blackface performers. Dixion created the one man, show but these men created a troupe of blackface performers. They also firmly established the image of blacks as happy-go-lucky plantation darkies, outrageously dresses and ignorant. Although there were other blackface performers before them, these men were the only ones who could give a real show from the makeup to the costume. â€Å"By the 1840’s blackface performances had reached an unprecedented level of national popularity. â€Å"(Watkins) There were many performance troupes, even professional juvenile troupes. Each followed a standard; they had a three-act presentation. The first act opened up with a walkaround where the entire troupe came out made up in face paint and dressed in suits. They than gathered in a semicircle to alternate comic songs and jokes. Here is a common type of joke many used; it is called; Mr. Bones: â€Å"Does us black folks go to hebbin? Does we go through dem golden gates? † Mr. Tambo: â€Å"Mr. Bones, you know the golden gates is for white folks. † Mr. Bones: â€Å"Well, who’s gonna be dere to open demm gates for you white folks? † For many of the white people watching the show the most funny and exciting part was the joke telling. You read "How African American Humor has Evolved and the Way We Look at Comedy" in category "Essay examples" In the second act-the â€Å"olio or variety segment†- was the stump speech speaker. This occured when one member performed a comic, black version of a topic. Topics would range from, emancipation, women’s suffrage, education or another current political or scientific topic. The goal was to show how blacks could not comprehend nor interpret sophisticated ideas. The third and final part of the show was a slapstick plantation skit, featuring song and dance with costumed men and women dressed as slaves. After the Civil War, blackface troupes hired on free black men and women to perform with them. White audiences became upset and angry at many troupes. After the war and emancipation – during the reconstruction period constitutional amendments were passed to assure civil rights and voting rights for former slaves and some blacks were elected members of the House and Senate; Whites wanted to be assured that blacks were still inferior and blackface troupes were not showing this by continuing to hire blacks. Therefore, audiences depleted, and many troupes that had incorporated blacks started to perform on circuits like the â€Å"Chitlen circuit,† which hit most black owned theaters. Blacks who were part of the troupes started to branch off and start their own troupes. In doing this, they altered the usual blackface performance routine. First, they altered song lyrics, instead of singing songs that downgraded blacks; songsters would play on white fears and mock them. Many blacks took off the face paint and introduced musical comedies. Black musical comedies made many black performers successful. White already loved black music so the musical comedy fit right into the market. Still many of these comedies were on the circuit, and confined to black theaters. It was not until later that musical comedies were featured on Broadway. When musical comedies appeared on Broadway â€Å"Lyles and Miller a very successful team created a whole new approach to the comedies. â€Å"(Watkins) They presented at the end of their acts a group of women who danced and sang with the stereotypical attitude many felt black urban women had. This simple addition astounded Broadway and critics raved. Eventually, every black troupe evolved to use this form. Black Musical Comedies took blacks to another level of comedy yet, they were unable to shake the sambo stereotypical image given to them by white blackface performers. Licensed radio was introduced in 1920, because of the low budget and inadequate facilities, news shows and music provided by local groups dominated the airwaves. By 1922, there were over 522 licensed stations and radio sales increased from $1million in 1920 to $400million in 1925. By 1929, one in every three homes owned radios ten years later there was a radio in almost every home. Radio was a medium where its listeners could hear concerts, comic monologues, sporting events and political speeches as they happened. â€Å"(MacDonald, 1981) Radio at first initially ignored blacks, as in the blackface performance days they were imitated by whites. In 1925, Freeman F. Gosden and Charles J. Correll a minor duo debuted as musicians on a radio station in Chicago. They played at this radio station for a while and later moved to a station owned by the Chicago Tribune. There they were approached by management about doing a broadcast edition to the comic strip â€Å"The Gumps. † The two refused the offer but suggested an alternative, a black – dialect show. Gosden and Correll made a series based on two black names â€Å"Sam ‘N’ â€Å"Henry†, which would later become known as â€Å"Amos ‘N’ â€Å"Andy†. Sam ‘N’ Henry debuted on January 12, 1926 (Dunning, 1925-1976) The characters Sam and Henry still depended on the stereotypical images of blacks created during the blackface (minstrel) performance years. Blacks were superstitious, naive, easily influenced, lazy, ignorant and conniving. On March 19, 1928, three months after the â€Å"Sam† ‘N’ â€Å"Henry† show had been cancelled, â€Å"Amos† ‘N’ â€Å"Andy† mysteriously appeared on a rival station in Chicago. Gosden and Correll had come up with the idea presented it to the station and it was accepted. This show was far more successful than Sam and Henry; Amos N Andy was recorded and leased to forty other radio stations. In August 1929, Pepsodent became the first major sponsor of a black comedy show. Amos N Andy was the number one show in the country. By 1935, 70 percent of American home (40 million) listeners tuned in each night. Sayings from the show hit the streets â€Å"Ain’t dat sumptin’,† â€Å"Splain dat to me’,† and â€Å"Holy Mackerel† became popular. Even with its popularity, the show had a down time. Radio stations modernized their broadcast methods; comedians were no longer forced to work without an audience. This is when variety shows begin to take the market. In 1943, Gosden and Correl returned to the air with a thoroughly revamped half an hour version of â€Å"Amos† ‘N’ â€Å"Andy†. The show was performed before a live audience and featured an orchestra and chorus. â€Å"Amos† ‘N’ â€Å"Andy† represented a breakthrough for black comedians on radio and television as well. Although one-person acts were not popular during the variety show period, Moms Mabley set the stage for many comedians that would come after her. Jackie â€Å"Moms† Mabley. Born in North Carolina in 1897, Mabley grew up in Cleveland Ohio, by the time she was sixteen she had became a stage performer. She began as a dancer and singer and dabbled in comedy. During the 1920’s, she was performing on the chitlen circuit in Dallas, where another teams saw her act and helped her get better bookings. Like many performers, she appeared in skits with other performers at first. However, Mabley did not like this and she was one of the first comics to turn to monologue humor. She appeared on the stage with oversized clodhoppers, tattered gingham dresses and oddball hats she acted like a typical down to earth older black woman. Mabley worked with many performers but she did her best when she was alone. She was famous for her costume and her shuffle, she would sing some comical version of a popular song, tell stories or just stand there and the audience loved it. Mabley foreshadowed the shift to direct social commentary and stand up comic techniques that would dominate humor and comedians to come. Dick Gregory, Flip Wilson, Redd Foxx, Steve Allen, Richard Pryor, Whoopi Goldburg, Eddie Murphy, and many other popular black and white comedians have evolved from the history of comedy. The images that were passed on from slavery still thrive at the root of jokes many comedians of today tell. Black comedians have finally gotten away from the white interpretation of black humor and created original black humor from an African American perspective to the world. Black comedy has come to be the voice of the struggle, pain, and joy African American people have gone through and are continuing to going through. Humor will continue to be a driving force to bring people of all ethnicities together to laugh at the good and bad times of our country. Without humor, would we really survive? How to cite How African American Humor has Evolved and the Way We Look at Comedy, Essay examples

Career Management for Personal Career Development- myassignmenthelp

Question: Discuss about theCareer Management for Personal Career Development. Answer: When I consider all of the assignments done before, I can state for me that the expert and entrepreneurial career which has been depicted by Kanter, is the most reasonable option for me to actually shape my persona The individual profession advancement development design will incorporate this piece of learning through associates and along these lines a ton of me being included as a key asset will be excessively useful for me. Additionally, for my improvement, I will ensure that I keep my trademark and USP of Excellence Is My Foundation" as my field information of business counseling. (Inkson, 2014). I need to really ensure that I develop as a business advisor and subsequently I develop myself as a person with the correct aptitude. It is where we live, the work we have done, the degrees we have and thus, my family background even affects the choice of job. This analysis requires a proper development plan and that can be on the reflective practice which allows me as a student to unders tand how development plans can be made using concepts. (Bubnys Zavadskien?, 2017). As a student who is settling my career path and college, I trust that I can set clear vocation objectives that can control me in accomplishing my professional aspirations. I found that not every person accomplishes the proposed profession yearning since a few people have worked in one position for their whole careers. With SMART objectives, I trust I can exceed expectations to the most noteworthy echelons in my field to end up a standout amongst the best individuals and accomplish the most elevated purpose of realization. Expanding on the professional decision and model proposed by Granovetter's idea of 'the quality of weak ties', I look at the results of the vocation counsel by feeble ties verses by solid ties. The key outcome is that accepting assistance from the strong and weak ties is associated with early employment and vocation settlement. Then again, the stronger binds are probably going to prompt assertiveness. I also discovered individual help, good example and expert companions are the solid elements and partners' business advancement is a very strong factor. (Carolan, 2005). I will do the following as a part of the plan Will enhance my correspondence skills Will enhance my aptitude Will build up my skill set More agreeable in nature Bringing some transformational change in my association at my level In totality I will be focusing on: ? Communication ? Interpersonal Skills ? Life skills ? Problem Solving Reference from the Plan Key result area as per GROW Indicator of success/ performance Status report/results To have growth in the required field of Business Consulting To increase the efficiency Additional Clients and learning in this field To have growth in the required field of interest like finance and HR To provide service quality by being efficient with skill set Achievement of new goals and plans To have growth in the required field of interest like finance and HR To achieve the self-maintained goals as per the plan Achievement of correct career path after college with interest References Inkson, K., Dries, N., Arnold, J. (2014).Understanding careers: Metaphors of working lives. Sage. Husu, H. M. (2013). Bourdieu and social movements: Considering identity movements in terms of field, capital and habitus. Social Movement Studies, 12(3), 264-279. Bubnys, R., Zavadskien?, L. (2017). Exploring the concept of reflective practice in the context of student-centered teacher education. Proceedings of the International Scientific Conference, 1, pp. 91-101. Carolan, B. (2005). Strong Ties, Weak Ties: Relational Dimensions of Learning Settings. Retrieved on 17th March 2018 from https://cdn.tc-library.org/Edlab/EdLab_Strongties.pdf Tmen, S. (2017). Career choice and the strength of weak ties: Career choice and the strength of weak ties. 17(3). 91-97

The Holocausts Effects On Wiesel Essay Example For Students

The Holocausts Effects On Wiesel Essay The Effects of the HolocaustOn Wiesels FaithIn early 1944 the town of Sighet, Transylvania was overran by the Nazi war regime as it rapidly expanded across Europe and parts of Asia. In this town a young religious man named Elie Wiesel was questioning the intent of the German army and the rumors that were circling about them. Although he had heard that the Germans were planning mass genocide of the Jewish race, the common feeling throughout the town was that Hitler could never exterminate every Jew. Early in Wiesels Night, he recounts his experiences in the Holocaust and he expresses his undying faith and belief that god would never allow Hitlers regime to run its course. When the Nazi army finally reached the town of Signet, the Jews were forced from their homes and relocated into the towns gettos. We will write a custom essay on The Holocausts Effects On Wiesel specifically for you for only $16.38 $13.9/page Order now It was the seventh day of Passover, and according to Wiesel, the race towards death had begun.1 The Jews were slowly removed from the large getto of Sighet and shipped to the smaller, holding getto where they were separated according to sex, age, and physical ability, and prepared for shipment to Auschwitz. The day that Wiesel and his family were to be moved to the smaller getto of Signet, Wiesel demonstrates his faith in God by awaking early to perform his daily prayers. As he prepared to leave his home he said, I looked at our house, where I had spent so many years in my search for God; in fasting in order to hasten the coming of the Messiah; in imagining what my life would be like. Yet I felt little sorrow.2 This passage is symbolic of his first parting with his faith in God. Yet he still believed in God, he was beginning to understand that a God should not let mass extermination happen to his people. While he was sub-consciencly loosing his faith in God, he still felt that there was strength in humanity and that human morals would never allow the burning of Jews. Upon Wiesels arrival at Auschwitz he caught his first glimpse of the crematories he exclaimed to his father, I do not believe that they can burn people in our agehumanity would never tolerate it.3 Yet after his father convinced him of the horrible truth his faith in god could never be restored.Wiesels father, after fully realizing the full horror of the concentration camps, said a small prayer to God, and to this Elie reacted with utter defiance. For the first time, I felt revolt rise up in me. Why should I bless His name? The Eternal, Lord of the Universe, the All-Powerful and Terrible, was silent. What had I to thank Him for?4 Although Wiesel still believed in the presence of God, he felt that in Gods silence he was defying the Jews and their faith in him. How could someone you are so devoted to be absent in your greatest time of need? Wiesel said that he sympathized with Job, and I feel that the similarities between Wiesel and Job are numerous. Both were very religious men who put their faith before all other, and yet both found that their faith brought them nothing but suffering. Both felt that they deserved a more peaceful and humane existence because of their undying devotion, yet both lived in the cruelest situations for some time. Wiesel felt that man was stronger that god because throughout the Holocaust his fellow prisoners continued to praise God and believed that God allowed the Holocaust in order to benefit the Jews in some strange way. Wiesel felt that because of all the torture that the Jews were subjected to their continued praise proved that they were ignorant to the fact that God was not a source of supreme justice. Wiesel continued to despise God for the remainder of the Holocaust, yet from this new independence he found power. .u1d3bc8d8d46dcb75e57caf918cc755f9 , .u1d3bc8d8d46dcb75e57caf918cc755f9 .postImageUrl , .u1d3bc8d8d46dcb75e57caf918cc755f9 .centered-text-area { min-height: 80px; position: relative; } .u1d3bc8d8d46dcb75e57caf918cc755f9 , .u1d3bc8d8d46dcb75e57caf918cc755f9:hover , .u1d3bc8d8d46dcb75e57caf918cc755f9:visited , .u1d3bc8d8d46dcb75e57caf918cc755f9:active { border:0!important; } .u1d3bc8d8d46dcb75e57caf918cc755f9 .clearfix:after { content: ""; display: table; clear: both; } .u1d3bc8d8d46dcb75e57caf918cc755f9 { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .u1d3bc8d8d46dcb75e57caf918cc755f9:active , .u1d3bc8d8d46dcb75e57caf918cc755f9:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .u1d3bc8d8d46dcb75e57caf918cc755f9 .centered-text-area { width: 100%; position: relative ; } .u1d3bc8d8d46dcb75e57caf918cc755f9 .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .u1d3bc8d8d46dcb75e57caf918cc755f9 .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .u1d3bc8d8d46dcb75e57caf918cc755f9 .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .u1d3bc8d8d46dcb75e57caf918cc755f9:hover .ctaButton { background-color: #34495E!important; } .u1d3bc8d8d46dcb75e57caf918cc755f9 .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .u1d3bc8d8d46dcb75e57caf918cc755f9 .u1d3bc8d8d46dcb75e57caf918cc755f9-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .u1d3bc8d8d46dcb75e57caf918cc755f9:after { content: ""; display: block; clear: both; } READ: Anne frank Essay I felt very strong. I was the accuser, God the accusedI was terribly alone in a world without god and without man.5Religion Essays

Christian Scriptures Essays

Christian Scriptures Essays Christian Scriptures Essay Christian Scriptures Essay Time Line Hebrews Israelites Nation of Israel with a King 1020 B. C. Destruction of Judas by the Babylonians 587 Time Line Foreign Domination Exile Persian Period 539 Greek Period Roman Period Judaism Monotheism Sacred Text; makes them unique Christianity Destruction of Jerusalem 70 A. D. Arrangement Hebrew Bible TANK Law/ Torah Prophets / Nevi IM Writings / Ketchum Old Testament Law / Pentateuch (five scrolls) History Wisdom Literature Psalms Prophets Law or Pentateuch Genesis, Exodus, Leviticus, Numbers, Deuteron Narrative History Structural / Legislative Law = ? Instruction / Teaching Nature of Creator Relationship of Created to Creator what does that god does, or gods, where do they operate, is it a god to trust Nature of Creation Relationship with each other human to human, human to god GENESIS Introduction Composite Documentary Hypothesis 0, E, D, P) 1ST word became the title Berkshire (Hebrew) = Genesis (Greek) = In beginning Etiology -beginning Chapters 1-11 Primeval Tradition Chapters 12-50 Ancestral History 1-11 Beginning of Life Creation (1-3) Killing/Cain Able (4) Genealogy (5) Flood story (6-9) Genealogy (10-11) Tower of Babel (11) how they became so diverse Symmetrical Structure 1:1 2:3 Command God said, and it was so, Execution Assessment saw that it was good, Time Counting of days Day 1 Animals, Humanity Day 7 Affirmation of Sabbath (most important institutions of Jewish life) Genesis 1:1 2:3 Order out of formless water darkness Spoken work = creation force Progression Climax with humanity Image of God = Male and Female Dominion, multiply and fill Very good! How does the 2nd description of creation in Genesis Differ from the first? 2:4 3 24 Creation Retold Setting= Land water God formed breathed Eden (garden of delight): 2 trees life Knowledge of good and evil Prohibition= Responsibility choice Answer to being alone Affirmation of marriage Serpent (Trickster) Temptation = ? Immediate Consequences relationship between Adam and eve, and god and them Penalty Serpent eternity and dust Woman pain in birth and subordination in life Man labor in the dust until he returns to it Removal Was? From the garden, because god did not wanted for the corruption that Adam and eve had wouldnt be perpetuated to future generations or forever. 8/29/12 Creation and Creation Corrupted (fall) in 1-3 Fallout 4-11 Noah: Re-creation Noah Covenant (6-9) What is the world situation as one enters the Noah story? How is Noah Depicted? One who walks with God, righteous How is God depicted in the story? The provider and the destructor What is to be concluded from the narrative regarding Noshs sacrifice in 8:20-22? After Noah gets down the boat he offers a sacrifice, and god reacts as l will never curse earth again because of humankind Humanity and evil filling the earth But Noah Forces- destruction and preservation Sacrifice and vow Blood means life If destruction is not the ultimate answer, what is? Redemption 1 1:26-25:18 Abraham 1 1:26-32 Introductory Information (line of seem) terra from Our to Harlan (Abraham, Manor, Harlan) Abram Sari-Important Info Lot-Nephew calling Abram, age 75 Faith Journey (Leave Harlan) Journey to Egypt (famine) Abram builder of altars Abraham Covenant 1. Many offspring (people) 2. Nation with land (Place/Promised Land) 3. Presence that protects 4. Blessing to all families of world (Purpose) Lot and Abram split (13-14) Covenant (1 5)* Lord: minor reward will be great Abram: inheritance goes to Likelier Lord: descendants will be as numerous as the stars Abram response0 1 Surrogate Parenting (16)* Abram, age 86 Sari Hager What causes the problems in the relationship between Sari and Hager? Hager can vive birth to children Shame Covenant (17)* Name change Abraham Sign of Circumcision ? Name change Sari to Sarah Abraham laughing and pleading for Shame Encounter at Hebrew (18)* Announcement and laughter of Sarah Negotiation between Abraham and the Lord will the righteous be swept away with the wicked? Fulfillment (21) Birth of Isaac Dismissal of Shame Abraham Tested (22)* Climax in Abraham narrative Threat/conflict Test Gift or gift giver Name? The lord will provide covenant Affirmed End of the Abraham Narrative (23-25) Death of Sarah Buried in the Cave of Michael Securing Rehab for Isaac. Death of Abraham Jacob 25-50 Isaac and Rehab Seas Lab Lea and Rachel Joseph How would you compare or contrast Jacob to his grandfather Abraham? Traditions Marriage within the family/clan Birthright Jacob 25 Struggle in the womb Birth Jacob Favoritism Birthright sold (Characterization) Covenant: Jacob (27) Intention of Isaac Blessing of Jacob Vow of seas Journey of Jacob At bethel (28) Lords Promise Jacobs Response Jacobs Journey In Harlan: Contest with Lab 20 years 2 wives: Rachel and lea 11 sons Jacobs return (32-33) Messengers messages Prayer Gifts Terror at Jabot Jacob becomes Israel Reunion with Seas

Economic Development Strategies of China after WWII Essay

Economic Development Strategies of China after WWII - Essay Example Deng did not held office as the China’s President or head of state, Premier, or even as the General Secretary or as the leader of the Communist Party, but still he is regarded as the â€Å"paramount leader† of the Peoples Republic of China mainly because of his far-reaching and successful economic reforms, which only transformed China to the current superpower status. So, when China’s developmental strategies after World War II are focused, it naturally refers to Deng’s economic reforms and the related developmental strategies. Considering this fact, the discussion will about how Deng’s reforms and developmental strategies, particularly his strategies to introduce foreign investment and technology into China’s economy, giving autonomy to state-owned enterprises, and the establishment of Special Economic Zones (SEZ) led to China’s optimum economic development. Deng came into the picture in the late 1970s when the patriarch of the Chinese Communist movement, Mao Zedong passed away in 1976 and importantly China was under a very pitiable economic condition. That is, under Mao regime, China following the footsteps of the erstwhile Soviet Union mainly developed many heavy industries, without diversification. This strategy provided little benefits for the average Chinese and even the normal consumer goods were scarcely available. So, â€Å"there was a prevailing sense among Chinas leaders that the economy was in crisis, and unless something drastic was done to improve human welfare, the survival of the regime itself was at risk† (Schuman 127). However, the leaders following Mao’s ideology wanted to continue the same economic strategy laced with Communist principles. On the other hand, Deng wanted to take the Chinese economy in an all-new direction. Instead of tinkering with the existing communist economic system, Deng wanted to la unch

To what extent was there a 'step change' in Britain's relationship Essay

To what extent was there a 'step change' in Britain's relationship with the EU in 1997 - Essay Example ion assists nations in establishment of steady and flourishing democracies, and it reduces the chance of a country in Europe becoming a rouge state, by developing solid reconciliation between the conflicting parties in a country. Therefore, the paper will develop counter arguments to discuss the extent of â€Å"step change† in the relations of Britain with EU during the period between 1997 and 2005. The â€Å"step change† initiative was characterized by Blair as a term refereeing to adaptation of the New Labor to a practical European policy. Moreover, there were other terms referring to the same initiative such as Blair’s active promotion of EU expansion; thus, this implies that the government became responsive to affairs concerning the European, thereby dealing with issues like Convention on the Future of Europe. In fact, aim was to arise, instead of leading though the initiatives of the government policy2. The government had international priorities and not European since the themes were running during the entire period, hence raising the concern of whether Britain was seeking eschew from the euro before 1997. Europe segregated the British labor party for a period of sixty years, compared to the conservatives who offer support in the process of the integration, though the Prime Minister, Attlee was faced with opposition. Moreover, the history of Britain would be expunged after joining the Common Market, and the Labor Prime Minister Harold Wilson had pragmatic reasons for his willingness to absorb Britain since it had lost the role as a leader in the world and due to deterioration of its economy. Therefore, by 1960, the leadership of the party would have resolved their differences on Europe relating to the segments of labor ranks and files while there was hostility by the labor movement to the notion of membership to the community of capitalist, since there was fear of increasing rates of unemployment3. In 1970, Britain took on a stance against the EU through

Department of Health and Human Services IT Security Program Research Paper

Department of Health and Human Services IT Security Program - Research Paper Example This policy outlines the framework by which the department ensures that its IT resources are protected when accessed remotely. The resources mentioned include all levels of sensitivity all existing automated information and systems. The policy includes mandatory rules for all organizational units, employees and other stakeholders. The roles and responsibilities are also outlined for the managers, security and IT officers. Building on the fact that pro-active security measures are implemented and maintained effectively, this policy outlines the rules by which malware or malicious computer applications and data are prevented from entering the system, detected and rooted out immediately. This policy is particularly directed at the employees who are tasked to gather, process and transmit HHS information and infrastructure resources such as the Chief Information Officer (CIO), the Deputy Assistant Secretary for Information Resources management and Senior Information Systems Security Officer. Through this policy, the Department of Health and Human Services, effectively, created the PII Breach Response Team. Consequently, the policy outlined the responsibilities, tasks, and mandate of the team such as the identification, management, and response to suspected or confirmed security breaches. This policy also created the HHS Information Security and Privacy Program, which was developed to support the Breach Re sponse Team. This is one of the several major policies that came from the office of the Chief Information Officer. It outlines the implementation for machine-readable policy for the agency’s websites. A core component of this policy is the satisfaction of best practices standards in terms of satisfying web privacy security, legal and regulatory requirements as well as the collection and protection of data.  

The Performance Measurement In Business Logistics Commerce Essay

The Performance Measurement In Business Logistics Commerce Essay Performance measurement can be defined as the process of quantifying effectiveness and the efficiency of an action (Neely, Mills, Platts, Gregory, Richards, 1994). Given the lack of any universally definition for performance in the organizational literature, it should not be surprising that extant literature offers many ideas about the dimension that ought to be incorporated into a conceptualization of logistics performance. One of the best examples is the framework where physical distribution effectiveness is defined as the extent to which distribution programmes satisfy customers [Rhea Shrock, International Journal of Logistics Management, 5, p. 3. supply chain management encompasses the logistics management which plans, implements, and controls the efficient, effective forward and reverse flow and storage of goods, services and related information between the point of origin and the point of consumption in order to meet customers requirements(Anonymous 2002). Performance measurement in the logistics functions, like starts at the individual metric level. Because of the great abundance of metrics already in existence there is forceful need for a method with which to evaluate the existing metrics. Quantitative and Qualitative measures are the two basic categories of Logistics indicators. Qualitative measures include such as product quality, customer satisfaction etc. and quantitative measures include such as order-to-delivery lead time, cycle time, flexibility, resource utilization, delivery performance, etc. Non-financial and financial are two broad categories of Quantitative metrics of supply chain performance. In fact, in the late 1880s return on investment (as a financial measure) was the main emphasis. (Schermerhorn et al.,, 2000). However as the second progressed during 1980s, the world market changed and overseas competitors began to take market share from the domestic and national companies who were unable to provide higher-quality products with lower costs and more diversity. National companies shifted their strategic focus from cost production to quality, flexibility and short lead time, as non-financial measures to gain the competitive edge in the market (Stewart, 1995). Business logistics performance metrics could also be classified as Operational Day to day technical representation developed schedule adherence avoiding complaints defect free delivery Inventory carrying cost(Levy (1997); Lee Billington (1992) Information carrying cost (Steward (1995) Tactical purchasing order efficiency Cycle time procedures booking Cash flow, Quality assurance flexibility transportation cost Capacity Strategic Rate of return on Investment Total cash flow time lead time comparison Quality level and quality assurance cost saving supplier pricing measuring against market(Gunasekaran et al. (2004) query time The critical elements that form the basis of logistics management are time, distance and money. Some utilization, productivity and effectiveness metrics used in the logistics management are: Dimension Metric Example Utilization Actual input/norm input Area of warehouse occupied/ total area Productivity Actual output/actual input Ton-miles delivered/cost incurred No of orders processed/ no of hours of labor Effectiveness Actual output/norm output No of shipment on-time/no of shipment sent Utilization measures: They are used to track the use of input resources in process. In logistics, input could be characterized as financial, physical assets or inventory. Utilization metrics include the following: Spending measures Purchase price variance Distribution cost as percentage of sales Variance of transportation cost from budget Non financial resources measures Usage ratios Amortized costs Inventory measures Static metrics (capture level of inventory expressed in physical, financial or other terms) Flow metrics (capture speed of inventory as it flows through the system over a period of time) productivity measures Partial productivity measures (SFP-single factor productivity ratios ) Total factor productivity measurement Financial productivity measurement (ROI-return on investment )( (Frameworx, 2005) Effectiveness metrics Order fill rates( order filled /orders requested Line item fill rates( total line items not filled / shipped in time per period Damage rates (line items damaged per order) Order cycle time (elapsed time between receiving request and delivering order) Delivery or transit time (elapsed time between readying order for shipment and delivery order)( DfT, 2004) On-time ( orders shipped on time or orders received by customer on time ) Perfect deliveries (orders received by customers with no logistics service fullness) Importance of performance Measurement The importance of measurement is everywhere as you get what you inspect, not what you expect. Hence, the importance of performance measurement cannot be denied. Therefore, to evaluate work done and to direct the activities metrics are required ((Melnyk et al. 2004). . Pressures (globalization, severe competition, and changing customers needs) are significantly driving force in the present era requiring the organizations to re-focus on utilizing of people and resources based on organizational objectives. A performance measurement system is needed to evaluate the resource utilization so that the organizations can strategically manage and properly control. It has been pointed out that in order to take action for ensuring desired results a performance measurement system is essential tool of controlling process. (Schermerhorn and Chappell, 2000) Measuring performance is necessary, because of the following reasons (which vary from organization to organization) are 🙠 Parker (2000) Success identification Measuring whether they are fulfilling the customer requirements; Help them understand their processes: Problems bottlenecks waste, etc. Identification Making sure that decisions are based on fact, not on supposition, emotion or intuition; and Disclose improvement planned, actually happened. Case Example To fully utilize the performance measurement system of logistics a firm has to implement latest technological infrastructure so efficient logistics operations could work flawlessly. Here we examine the case of Transcom Inc. that is a known to be the one of the leading edge a distributor of seals and bearings in Burnsville, Minn. it has successfully enhanced its performance measurements in its supply chain operations through implementing and incorporating latest technological measurement tools in its supply chain operations. Transcom was able to find numerous ways to speed up the order-to-ship process and reduce costs through this strategy that is through effectively measuring the performance of the logistics operation with the help of appropriate technology. Analysis of performance data resulted in improved inventory control, increased product turns, increased shipment volumes and reduced line-item labor costs. Implementation of technological performance measurement tools increased the not only efficiencies of Logistics such as efficiencies in our distribution center but also created efficiencies purchasing, inventory control and customer-service departments. (Dennis Bollinger 2006) Conclusion: The a firms approach in establishing logistics measurements system does not matters a lot as the real value come when the information is acted upon to align the effectiveness and efficiency of the logistics process performance to value the customers. The role 3PL can have in your success is dependent on when you start measuring your logistics performance (james S. Keebler and David A. Durtsche 2007). One of the logistics challenges is that organizations have to be more responsive, with high levels of flexibility in delivery. The emphasis should be on processes and performance rather than on functions and profit. The competitive battleground will be in the fields of quality, productivity, speed and innovation. Progress towards performance excellence will be aided greatly by relevant and integrated measurement frameworks and models (Christopher (1994).

Free Great Gatsby Essays: Philosophic and Political Contexts :: Great Gatsby Essays

The Great Gatsby: Philosophic and Political Contexts Attempting both a sustained close reading of the novel, and the relocation of that reading within wider philosophic and political contexts, one must therefore consider the impact of a broad mystical strain of Western thought upon Fitzgerald's political analysis. For while it is a commonplace that Fitzgerald was fascinated, throughout his life, with what is variously conceived as the "ideal," "the Dream," "inspiration," the "visionary," or "Desire," a tradition with which the book opens, the political uses of the ideal have largely escaped notice. It seems hard to believe in our period, when a three-decade lurch to the political Right has anathematized the word, but F. Scott Fitzgerald once, rather fashionably, believed himself to be a socialist. Some years before, he had also, less fashionably, tried hard to think himself a Catholic. While one hardly associates the characteristic setting of Fitzgerald's novels, his chosen kingdom of the sybaritic fabulous, with either proletarian solidarity or priestly devotions, it is clear that a tension between Left and religiose perspectives structures the very heart of the vision of The Great Gatsby. For while Gatsby offers a detailed social picture of the stresses of an advanced capitalist culture in the early 1920s, it simultaneously encodes its American experience, at key structural moments, within the mitigating precepts of a mystic Western dualism. Attempting both a sustained close reading of the novel, and the relocation of that reading within wider philosophic and political contexts, one must therefore consider the impact of a broad mystical strain of Western thought upon Fitzgerald's political analysis. For while it is a commonplace that Fitzgerald was fascinated, throughout his life, with what is variously conceived as the "ideal," "the Dream," "inspiration," the "visionary," or "Desire," a tradition with which the book opens, the political uses of the ideal have largely escaped notice. Fitzgerald's excitably visionary sensibility, nourished in high school years by Catholic mysticism, fashioned him into a superbly perceptive critic of the appropriation of human need of the ideal by developments in American capitalism in the 1920s. In response to economic crisis in the early years of this decade, the national advertising media developed and promoted a new cult of glamour, seeking through its allure to create a mass consumer market and revivify the foundering work ethic. Fitzgerald's entrancement by the suggestive power of beauty sensitized him both

Cooking Equals Art Essay

You know the saying â€Å"The Way To A Man’s Heart is Through His Stomach†, well I think everyone would agree with me when I say the way to anyone’s heart is through their stomach. Cooking has to be done during one’s life time; it is not something that can be easily avoidable. It’s something many people do on regular basics and has become an expert in. What you do every day consider art. Art can be acknowledged as something that is created and then just consumed. Yes. Cooking is art because cooking is doing something that you do repeatedly, and have a general or higher knowledge in. Cooking takes you to the highest of the high. Exactly what is cooking? Something so essential has a very simple meaning. It is the time process of food preparation through applied heat. While cooking, a person has to keep in mind a lot of other factors that finally lead to the product of making delicious food. Art according to the OED is the skills of doing something that you have had knowledge of or practice. (Art) Comparing that to cooking, we can easily pop in cooking where art is and say; cooking according to the OED is the skills of doing something that you have had knowledge of or practice. That however is not true for both of those statements because one man’s masterpiece of art can be 5 dramatic lines on a canvas, while one man’s masterpiece of cooking can just be a plate with steak, peas and cranberry sauce. The assortment and place of the line and food on a plate though would be considering art. Our ancient ancestors first discovered that heat could be applied to make food taste better. This was the evolution of cooking. Cooking has not become extinct, now over tens of thousands of years later. Rather than that it has grown into variations and forms that are extremely creative in expression and infinite. According to the latest paleo-archeological information, the oldest art was created by humans during the prehistoric Stone Age, between 300,000 and 700,000 years ago. (Visual Arts) Most anthropologists believe that cooking fires began only about 250,000 years ago. Primatologist Richard Wrangham suggested that cooking was invented as far back as 1. 8 million to 2. 3 million years ago. (The Executives Stulum). Only 50,000 years apart, cooking first, art and cooking were very close in relation. The diversity of location was a major play in why cooking styles, techniques, and even food was different. Due to diverse ecosystems and climates early civilization had to use the resources and technologies that were available locally. The Chinese, as an example, developed wok cooking as an answer to the scarcity of firewood. By cooking over a small hot flame and stirring constantly to prevent burning the food, the use of fuel was maximized. (Art Form). Just how art was forming 50,000 years later due to the location art was also different in parts of the world just like cooking. Food can be considered as an art; for example: the decoration of a food, the way a food is constructed in the plates, or even the way many different foods are being mixed in order to create a new food. Sometimes even people consider the arrangement of plates in a table as an art. This is called Table Art. Brillat-Savarin in his book, â€Å"The physiology of taste† states that cooking is the oldest of all arts. He says that Adam was born hungry and even a new born child first looks for become feed by his nurse right after he comes to new world (Physiology of taste, 300). He also believes that cooking and food is the finest art that has had the most influence on humans’ civilization (300). Food is one of the fewest things in the whole world that almost everyone becomes satisfied with. When people eat, a kind of satisfaction and pleasure makes them happy. But happy is not the only expression connected with food you have happy, disgust, anger, delighted and many more. Everybody is different and just how one dish can make a person happy by it, it can make another person disgusted by it. Everyone would get their very different experience, just how you would look at art and experience a different reaction. Whereas you look at a bright painting and feel intrigued but the person next to you is confused. In art you need your utensils to create a piece of work. The same rule applies in cooking. Yes in cooking you don’t need to use any other instruments to help you cook other than your hands which by the way brings out the artist ability right there. But you can prepare the food to get that extraordinary flavor. A good cook is also a creative one. He or she is not afraid of trying new ways and exploring new methods. He or she has an experimental mind that is coupled with a good sense of taste. The problem is that, because of the experimental nature of the work, the process of creating a masterpiece can get lost in the act of creation. However, the process of creating a culinary masterpiece does not stop there. There must also be a stage of ever refinement to the basic process. For example, should less sugar be added? Should I add more spices? Should I lower the temperature of the heat? These are little adjustments to the process that will turn a recipe from being â€Å"just OK† to â€Å"excellent. †(Art Form) For that, a good cook is not only a creative one. He or she is the master of their masterpiece. The ability to improve upon an old recipe or create an exciting new recipe is a talent a very special few can accomplish with little or no training, but almost anybody with the proper training and a genuine interest in excellent food and its preparation can become an exceptional imaginative chef. Cooking is something that cannot be learnt. In art the qualities of a cook must be ingrained in a person. But that does not mean that you cannot learn a few scrumptious dishes. Works Cited â€Å"art, n. 1†. OED Online. September 2011. Oxford University Press. 12 October 2011 Brillat-Savarin, Jean Anthelme, and M. F. K. Fisher. The Physiology of Taste, Or, Meditations on Transcendental Gastronomy. New York: Knopf, 2009. Print. â€Å"Cooking history and info†. The Executives Stulum. The Executives Stulum, 09 Oct. 2011. Web. 13 Oct. 2011 â€Å"cooking, n. â€Å". OED Online. September 2011. Oxford University Press. 12 October 2011 â€Å"Earliest Art of Prehistory† Visual-art-corks. com. Encyclopedia of Art. 19 Jan. 2009. Web. 13 Oct. 2011 Murray, Richard â€Å"Cooking As an Art Form. † EzineArticles. com. Ezine Article Group, 12 Feb. 2010. Web. 12 October. 2011.

Free Essays on Racisam

I was thinking about topics for my essays, and a lot of things popped into my head like for example how about start and connect my opinion on one of my favorite movies? This one I believe that I can write about and make sense out of it, its about Racism and I believe that everyone can relate because we are either racists or not. American history X is the title of the movie. American History X focuses on the life of a skinhead. The main character of this movie is Edward Norton. Edward Norton as Derek Vinyard, a Southern Californian skinhead who must do time after committing a hateful murder. Once in jail, his mind opens and he actually thinks and he sees the error of his ways. Upon reentering the real world, he must now turn his attentions to his younger brother Danny, who is heading down the same path as his brother. The movie's main storytelling device centers on Danny's excellent writing ability. After turning in a report of Hitler's "Mein Kampf", when asked to discuss a book about civil rights, Danny's now being forced by a hard-love school teacher to write about his brother Derek's journey from the "heights" of murderous skinhead leadership to the brutal rape in a prison shower. In the film there are a lot of scenes of racial violence: of black youths kicking a helpless white student in a high school restroom; of a Korean-owned grocery store terrorized by skinhead thugs; of an African American whose skull is split open by a skinhead who orders him to lie face down on a curb. Unlike many Hollywood films, it shows this young man's evolution. He sees all the destruction that hate causes, not only to society at large, but also to his own family. There lies point of my essay, the lesson: Everyone suffers from hate crimes. At times it is difficult to tell what message this movie is trying to put across. We know that in general, being a racist is wrong. But, while watching this movie, I, and I’m sure many others, ... Free Essays on Racisam Free Essays on Racisam I was thinking about topics for my essays, and a lot of things popped into my head like for example how about start and connect my opinion on one of my favorite movies? This one I believe that I can write about and make sense out of it, its about Racism and I believe that everyone can relate because we are either racists or not. American history X is the title of the movie. American History X focuses on the life of a skinhead. The main character of this movie is Edward Norton. Edward Norton as Derek Vinyard, a Southern Californian skinhead who must do time after committing a hateful murder. Once in jail, his mind opens and he actually thinks and he sees the error of his ways. Upon reentering the real world, he must now turn his attentions to his younger brother Danny, who is heading down the same path as his brother. The movie's main storytelling device centers on Danny's excellent writing ability. After turning in a report of Hitler's "Mein Kampf", when asked to discuss a book about civil rights, Danny's now being forced by a hard-love school teacher to write about his brother Derek's journey from the "heights" of murderous skinhead leadership to the brutal rape in a prison shower. In the film there are a lot of scenes of racial violence: of black youths kicking a helpless white student in a high school restroom; of a Korean-owned grocery store terrorized by skinhead thugs; of an African American whose skull is split open by a skinhead who orders him to lie face down on a curb. Unlike many Hollywood films, it shows this young man's evolution. He sees all the destruction that hate causes, not only to society at large, but also to his own family. There lies point of my essay, the lesson: Everyone suffers from hate crimes. At times it is difficult to tell what message this movie is trying to put across. We know that in general, being a racist is wrong. But, while watching this movie, I, and I’m sure many others, ...

Essay about Learning and Sales Assistant

Essay about Learning and Sales Assistant Essay about Learning and Sales Assistant TASK 2: Employability, Personal & Communication skills. Sales Assistant job in Bentalls (Kingston) Employability Skills:- Employability skills Assess why each employability skill is important to Bentalls for a sales assistant and any job in general Why must HR look for this employability skill when interviewing? How important are employability skills to the successful running of the centre? Rate from 1-5 (1=most important & 5=least important) Apply situations within the daily running of the centre How do good employability skills ensure employees keep their jobs? suitable qualifications For sales assistant a suitable qualification would be C+ in Maths and English, this is because they would have to know calculations off by heart and also they have to know basic English to communicate with the customers. HR must look for this employability skill even before interviewing to ensure that the candidate has the qualification so that they can process the application and call them through for the interview. 2- It would be important because this is what they would require the most when applying for the job as this decides if you have the qualifications to apply or the job or if you are suitable for the job. Because they would require someone who can speak English and can do basic maths otherwise they would struggle to communicate or if calculating something manually. experience in similar role This is required so the candidate have knowledge of what they will be doing, and what they want each sales assistant to be like. HR must look for this skill to see if the candidate has had any sort of experience so they can see if the candidate is capable of the job. 2- It would be important because the candidate would need some sort of experience and idea of what they will be doing. If they don’t have any sort of experience then it would be difficult for them to work in a retail environment. Knowledge of products/services This would mean that the candidate would already have the skill and this is not necessary in training. HR must look for this skill to know if the candidate has any sort of knowledge of the products to be able sell it to a potential

Remedies and Restitution Assignment Essay Example | Topics and Well Written Essays - 1750 words

Remedies and Restitution Assignment - Essay Example In reviewing the tort of negligence and the alleged prevalence of the â€Å"blame culture†, it is important at the outset to consider the theoretical justification for fault based liability in tort, which has arguably extended the concepts of duty of care, which in turn has fuelled a blame culture. To this end Hassan El Menyawi propounds that such an evaluation is essential to a meaningful comparison of the arguments for and against a no fault scheme in the tort of negligence: â€Å"On a formalist account, a theory of justification stands for the idea that law is not merely a huge collection of separate and disparate norms, but a cohesive social arrangement, which is describable in the form of one or more several moral values†¦Ã¢â‚¬ ¦. We adopt this methodology and account for tort law by exploring a variety of distinct justifications3†. This concept of â€Å"moral values† underpins the current fault based liability for negligence in the framework of a system of â€Å"corrective justice†. The fundamental difference between the corrective system and the no fault system of distributive justice relates to the legal approach to the structure of interactions. For example, corrective justice centres on the â€Å"transaction4† between two parties, whereas distributive justice is rooted in a distribution whereby compensation is awarded to members of a group. As such, Weinreb5 comments that: â€Å"To take a modern example, the legal regime of personal injuries can be organised either correctively or distributively. Correctively, my striking you is a tort committed by me against you, and my payment to you of damages will restore the equality disturbed by my wrong. Distributively, the same incident activates a compensation scheme that shifts resources among members of a pool of contributors and recipients in accordance with the distributive

Comparing and evaluating the financial performance of US commercial Essay

Comparing and evaluating the financial performance of US commercial banks during the recession - Essay Example The study tells that the recent financial crisis began in 2008 – although signs of the crisis could be identified in 2007; since then, the crisis has being expanded in all countries worldwide causing severe losses to businesses of all industrial sectors. In its primary form, the crisis was related with the banking sector in US; in fact, the subprime products that were promoted by the US banks were proved to be more risky than initially estimated; as a result, US banks were highly exposed to the recession. Many banks in US collapsed – as a consequence of the crisis; however, there were also those banks that managed to limit the losses and protect effectively their equity/ capital. This study will help to understand the effects of recession on the financial performance of US commercial banks using the figures included in these organizations’ financial statements. In other words, it will be an evidence – based study not just a critical analysis of the behavio r of these firms since the beginning of the crisis. On the other hand, the level of resistance of US banks – as identified through this study – would be valuable in order to estimate the expected development of the US banking industry both in the short and the long term – the prospects for the development of US firms that operate in other industrial sectors could be also estimated using similar criteria. The study also identifies the framework of successful strategic decisions – referring to the banking industry – a fact that could further lead to the increase of this sector’s credibility.

Critique of a Political Speech Essay Example | Topics and Well Written Essays - 1000 words

Critique of a Political Speech - Essay Example For the first appeal, or Ethos, it is usually utilized for the description of the speaker’s credibility or authority in the subject he is talking on. It presents the questions, what authority does the speaker to talk on the topic or â€Å"is the speaker knowledgeable enough?† Ethos also pertains to the charisma of the speaker, on whether he has captured or garnered the respect of his audience for them to listen to what he has to convey. In the speech of Obama, it is clear that the element or appeal of Ethos is present. Since it is Obama’s inaugural speech as the 44th President of the United States, he obviously has the authority, charisma, and trust of the audience. In his speech, he reminds the audience of his inauguration as the 44th President of the United States, offers his thanks and gratefulness for his victory and at the same time, and recognizes the enormous responsibility he is to undertake from his predecessors. Typical to many political speeches, ethos is established during the introduction where a speaker attempts to garner the trust and confidence of his audience. He posits in the initial paragraphs of his Inaugural speech, â€Å"Forty-four Americans have now taken the presidential oath. The words have been spoken during rising tides of prosperity and the still waters of peace. Yet, every so often the oath is taken amidst gathering clouds and raging storms. At these moments, America has carried on not simply because of the skill or vision of those in high office, but because We the People have remained faithful to the ideals of our forbearers, and true to our founding documents.† What can be appreciated from Obama’s speech with regard to ethos would be that Obama presented his authority and charisma in a very humble manner. He did not appear to boast that he is now the latest President of the United States, but instead conveyed an aura of humility. He begins by saying, â€Å"My fellow citizens†, where he at tempts to present himself as another ordinary American citizen, and he again mentions, â€Å"I stand here today humbled by the task before us, grateful for the trust you have bestowed, mindful of the sacrifices borne by our ancestors.† Obama even sought to praise the achievements of then-President George W. Bush, which would have to a certain extent, healed wounded political scars in the recent elections. He stated, â€Å"I thank President Bush for his service to our nation, as well as the generosity and cooperation he has shown throughout this transition.† For the second appeal, Logos, it is the employment of reason and logic to persuade the audience. Through the use of facts, statistics, and researches as evidence, the speaker convinces the audience of the truth and validity of his claim. As expected of a prominent lawyer, a former Senator, and the new President of the United States, Obama is well-informed, well-researched, and well-versed with political developments . In his speech, Obama presents the current problems of the United States. He states in paragraph 4, â€Å"That we are in the midst of crisis is now well understood. Our nation is at war, against a far-reaching network of violence and hatred. Our economy is badly weakened, a consequence of greed and irresponsibility on the part of some, but also our collective failure to make hard choices and prepare the nation for a new age. Homes have been lost; jobs shed; businesses shuttered. Our

Phuket Beach Analysis Essay Example for Free

Phuket Beach Analysis Essay Statement of the Problem Should the management of Phuket Beach Resort accept the offer made by PlanetKaraoke Pub to set up an outlet inside the hotel or should the managementoperate a pub, Beach Karaoke Pub, by itself? II. Case Background Mike Campbell, General Manager of Phuket Beach Hotel is considering an offermade by Planet Karaoke Pub, a fast expanding company, which is looking for avenue in Patong beach area for setting up another outlet. The Board of Directorsof the establishment had previously rejected several old offers because it offerslow return on investment. The space was located on the second floor of the main building and was verymuch under-utilised. Planat Karaoke Pub offered to sign a four-year leaseagreement with the hotel for rending part of the unused space. It proposed topay:a. a monthly rental fee of 170,000 baht for the first two years; andb. thereafter, a 5% increment for the next two years. Planet Karaoke Pub required only 70% of the unused space measuring 3,000 sq. feet. This would allow the hotel to keep the remaining space for the creation of analley two years later. Mike Campbell is contemplating on creating a pub operated by the managementof the hotel itself since such establishments attract a lot of customers andtourists. Mike Campbell sought the assistance of Kornkrit Manming, the hotel’s FinancialController to review the offer from Planet Karaoke Pub and estimating revenuesand costs associated with an alternative project, Beach Karaoke Pub. III. Objectives With the given two alternatives on hand, this case aims to:a. ome up with a concrete recommendation to the board of directorsof Phuket Beach Resort of which of the two alternatives will offer a higherreturn on investmentb. determine if operating a pub in the hotel, whether by a third party orby management, will be a good investment on the part of the hotel. c. compute for the relevant cashflows associated with each projects? The 25% fear factor is applied on the projected annual net room revenuerepresenting 50% of the pub revenue – 50% from hotel guests. . Overhead expenses allocated to the Planet Karaoke Pub project amountingto 55,000 baht and 16% of sales representing salaries for the Beach KaraokePub project are considered irrelevant costs since these costs will not differbetween alternatives. Both are allocated costs. 5. The weighted average cost of capital is 10. 75% computed using 10%interest rate and 12% hotel owners’ cost of equity on its capital structureconsisting of 25% debt and 75% equity respectively. The cost of equity isassumed to be after tax. 6. All payments and inflows assumed to have been made at the end of theyear. The two projects have unequal lives: Planet Karaoke Pub to run for 4 yearswhile Beach Karaoke Pub to run for 6 years. 8. It was envisaged that the proposed pub would not affect the hotel’s futureexpansion plans. 9. The existing system ranked projects according to their average return oninvestment and payback period, regardless to the time value of money. 10. Similar development proposals had been rejected by the board because itrequired a long payback period. Other proposals were also discarded due toits low return on investment.

A Silent Mutation With Unknown Mechanism Biology Essay

A Silent Mutation With Unknown Mechanism Biology Essay A silent mutation with unknown mechanism of C1311T in exon 11 combined with IVS11 T93C (G6PD 1311/93) has been reported in G6PD deficient individuals in many populations. In our previous study, G6PD 1311/93 was identified as the common G6PD variant in one of the Malaysian aboriginal groups. Here, we report the screening for this variant via PCR-RFLP method and then direct sequencing of the entire 3 ´UTR of the G6PD gene in 175 aboriginal volunteers and 45 non-aboriginals. In the aboriginal group, 72 individuals (41%) carried the G6PD 1311/93 while 6 individuals (13%) were identified in the non-aboriginal set. Three novel SNPs, ss218178027 (+272 G/A), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) were discovered in 3 ´UTR. SNP ss218178024, which is located inside an AG-rich region, has shown a significant association with G6PD 1311/93 as it was observed solely in individuals with G6PD 1311/93. Computational analyses indicated that three miRNAs have potential to bind to the reg ions encompassing ss218178024. Whilst transitions of A to G dose not destroy these miRNA target sites, it extensively alters the mRNA secondary structure and creates a putative hsa-miR-877* binding site. Notably, ss218178027 and ss218178028 do not change mRNA secondary structure. It could be speculated that ss218178024 have a potential functional effect on the down-regulation of mRNA and consequently G6PD deficiency either by affecting mRNA secondary structure or mirRNA regulation process. This is the first report of clinical association of a SNP in 3 ´UTR of G6PD mRNA. Genetic variations in the G6PD gene are responsible for G6PD deficiency in humans. More than 140 ethnic reliant nucleotide variations in the G6PD gene have been reported (Nkhoma et al 2009). Most of these variants are single missense mutations, with the rest being either double or triple missense mutations or small in frame deletions (Cappellini, G Fiorelli 2008). All these mutations alter the protein sequence of the G6PD enzyme by either amino acid substitution except for a silent mutation of C1311T in exon 11 combined with IVS11T93C (designated here as G6PD 1311/93). This genotype has been reported in G6PD deficient individuals in different ethnic populations with different frequency (Vulliamy et al. 1991; 2000; Jiang et al. 2006; Daoud et al. 2008; Jalloh et al. 2008; Wang et al. 2008; Moiz et al. 2009 ). This combination is a special G6PD variant where the carrier is deficient without any changes to the protein sequence of the G6PD enzyme. From previous studies, association of th ese two has been shown as significant in reducing G6PD enzyme activity in some individuals and hence has clinical implications (Yu et al 2004; Wang et al 2008; Jiang et al 2006). It is notable that some of the individuals with G6PD 1311/93 presented with normal G6PD activity (Jiang et al 2006). Bearing in mind, it is reasonable to postulate that other change(s) in the G6PD gene with potential linkage disequilibrium by this combination is responsible for the enzyme deficiency. Importance of 3 ´UTR of human genes in the post-transcriptional regulation has been supported by finding of functional SNPs in the 3 ´UTR of a number of genes (ref). In the other word, genetic variations in the 3 ´UTR of some genes are associated with variety of human disease ( ref ). Cis-acting elements in the 3 ´UTR of human genes are key players in controlling of mRNA stability, localization and level of translation (ref). Conversely, according to a recent systematic search, 106 conserved motifs located in the 3 ´UTR of human gene are associated with post-transcriptional regulation which half of them likely are miRNA binding sites (Xie et al 2005). MicroRNAs (miRNAs) are a class of genes encoding short RNAs, which are known to inhibit gene expression by binding to the 3 ´UTR of the target transcript. Notably, miRNAs are predicted to regulate about 30% of all human genes by targeting sequences in their 3 ´UTR (ref) . Noteworthy, several SNPs inside the miRNA gene and the miRNA binding sites have been identified recently (ref). The associations of these SNPs with some disease like Parkinson and some kind of cancer have been documented (Sethupathy 2008; Shen 2008). Given that, in the present study, we sought to determine if any SNP in the 3 ´UTR of G6PD gene in G6PD 1311/93 is involve in the regulation of mRNA processing. Subjects and Methods This study was approved by the University Kebangsaan Malaysia (UKM) hospitals ethics committee. All subjects gave their written informed consent. In our previous study, we attempted to identify the molecular basis of G6PD deficiency in 25 deficient individuals from one of the Malaysia aborigine group, namely, the Negrito (data in press). Our earlier results showed that G6PD 1311/93 is the commonest G6PD variant in Negrito. No other mutations were detected in the remaining exons or adjacent regions of the G6PD gene for subjects with G6PD 1311/93. In the present study, blood was collected from 175 consenting volunteers from four sub-ethnic groups of Negrito namely Kintak, Lanoh, Jahai, and Bateq. A series of 45 non-aboriginal volunteers were selected as the reference group. Genomic DNA was extracted by using the Salting Out method (ref). The oligonucleotides used as primers were either designed by online primer-BLAST program or obtained from published data (Kurdi-Haidar et al. 1990). The G6PD gene sequence was obtained from NCBI (reference sequence NC_000023.9). Sequence of each exon was obtained from ENSEMBL (Transcript ENST000 00393562). Then two regions of the G6PD gene (region ab and cd in figure 1) were amplified using the PCR technique to detect variation in nt 1311 in exon 11and nt 93 in intron 11. A proportion of the PCR product from regions ab (207 bp) and cd (317 bp) were digested with the appropriate restriction enzyme according to the manufacturers instructions (New England Biolabs) and then run on 3% agarose gels, stained with ethidium bromide, and photographed under UV light. Region ab was digested with BclI and region cd was digested with NlaIII. For all samples, PCR direct sequencing was performed for 3 ´ UTR of G6PD gene by using 2 sets primer of ef (320 bp) and gh (397 bp). Figure 1: Schematic map of part of G6PD gene (exon 10 to exon 13). The arrows point to the positions of each primer site. Oligonucleotides a: 5 AAGACGTCCAGGATGAGGTGATC 3 and b: 5 TGTTCTTCAACCCCG AGGAGT 3 are the primers used to detect 1311 C>T transition. Oligonucleotides c: 5 TGGCATCAGCAAGACACTCTCTC 3 and d: 5 CCCTTTCCTCACCTG CCATAAA3 are the primers used to detect IVS11 nt93 T>C. Oligonucleotides e: 5 GAGCCCTGG GCACCCACCTC 3 and f : 5 TCTGTTGGGCTGGAGTGA 3 were amplified part of 3UTR and oligonucleotides g (5TCACTCCAGCCCAACAGA3) and h (5 GGTCCTCAG GGAAGCAAA 3) were amplified the rest of 3UTR of G6PD gene for sequencing. Bioinformatic Tools We used two computational tools for each section to confirm our results. F-SNP (http://compbio.cs. queensu.ca/F-SNP/) (Lee Shatkay 2008) and FASTSNP (http://fastsnp.ibms.sinica.edu.tw) (Yuan et al. 2006) was used to find putative functional SNP in 3 ´UTR of G6PD gene. The RegRNA program (http://regrna.mbc.nctu.edu.tw/) (Huang et al. 2006) and MicroInspector (http://bioinfo. uni-plovdiv.bg/microinspector/) (Rusinov et al. 2005) was utilized to identify the miRNAs binding sites inside 3 ´UTR of G6PD gene. Secondary structures of the full-length of G6PD mRNA and as well, 3 ´UTR was predicted using GeneBee (http://www.genebee.msu.su/genebee.html) and mFold (http://mobyle.pasteur.fr/cgi-bin/portal.py) (Zuker et al. 1999). The program RNAhybrid (http://bibiserv. techfak.uni-bielefeld.de/cgi-bin/rnafold_submit) (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy hybridisation of mRNA and miRNA. Results Genotyping DNA from 175 aboriginals and 45 non-aboriginals were screened for presence of G6PD 1311/93. In overall 72 aboriginal individuals (41%) and 6 non-aboriginal subjects (13%) carried this combination (table 1). Through direct sequencing of DNA fragments, three novel SNPs, of ss218178027 (+272 A/G), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) was found (Figure 2). SNP ss218178027 was observed in 6 subjects in aboriginal group with G6PD 1311/93 (table 1) inside of an AG-rich region (AGAAGGAAGGAGGAGG). SNP ss218178028 was observed in 4 aboriginal individuals which 3 of them carried normal alleles in 1311 and 93. None of our non-aboriginal samples carried ss218178027 or ss218178028. SNP ss218178024 also surrounds by other 30 bp AG-rich sequence (gggagggagggacaag ggggaggaaagggg) and it was observed in all those G6PD deficient individuals who carried G6PD 1311/93. In the absence of G6PD 1311/93, ss218178024 was not found. Females who were heterozygote for the G6PD 1311/93 were also heter ozygote for ss218178024. Figure 2. Partial nucleotide sequence of normal, heterozygote and homozygote females respectively for forward strand of ss218178024 (a1, a2, a3), reverse strand of ss218178027 (b1, b2, b3) and reverse strand of ss218178028 (c1, c2,c3). Arrows show position of each SNP. Table 2 SNP Individuals with G6PD 1311/93 individuals normal for G6PD 1311/93 ss218178024 ss218178027 ss218178028 Aboriginal individual 72 105 72 6 4 Non-aboriginal individual 6 37 6 0 0 Bioinformatics Analysis Search for reported SNPs inside of 3 ´UTR of G6PD gene By using F-SNP and FASTSNP programs, we found six SNPs have been reported inside of 3 ´UTR of G6PD gene including SNP ref ID: rs1050831,  rs1050774, rs1050773, rs1050830, rs1063529, rs1050757.  The last one is actually same with ss218178024. All of these known SNPs were discovered via cDNA sequencing and to date no clinical associations have been reported for them. Prediction of putative miRNA binding sites and mRNA secondary structure The wild sequence of 3UTR of G6PD was submitted to regRNA and MicroInspector programs to detect putative miRNAs target sites. The mutant variant of ss218178024, ss218178027 and ss218178028 was also submitted to evaluate effect of each SNP on creating or destroying the miRNAs target sites. However, in silico analysis indicated that three miRNAs have potential to bind to the regions encompassing ss218178024A. Of note, SNP ss218178024 is located inside seed region of these miRNAs which are hsa-mir-204, hsa-mir-211 and has-mir-1249 (figure 3). Moreover, further computational analyses reveal that transition of A to G in SNP ss218178024 creates additional miRNA target site for has- miR-877* which also is located inside seed region. Neither ss218178027 nor ss218178028 is targeted by any miRNA. The RNAhybrid program (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy (MFE) hybridisation of mRNA and each miRNA. Figure 3 The predicted binding site for hsa-mir-211(A), hsa-miR-1249 (B), hsa- mir-204 (C) and hsa-miR-877* (D) at 3 ´UTR of G6PD gene. Perfect Watson-Crick or wobble base pairings between the 5 ´ end of the miRNA and the 3à ¢Ã¢â€š ¬Ã‚ ² UTR target sites was observed. The minimum free energy (kcal/mol) of hybridization is shown in parentheses. Position of ss218178024G is indicated by arrows. Using the program mFold and Genebee, we determined the potential effect of the SNP sequence alterations on RNA folding. As shown in figure 4, ss218178024G is predicted to alter the secondary structure of G6PD mRNA. Also, the free energy of full length mRNA and as well 3UTR predicted to be affected by this substitution. The lower free energy in wild type indicates that mRNA might be more stable in wild type compare with the mutant. In the other word, it is suggesting that altered mRNA is capable to faster degradation. We also submitted the substituted nucleotide sequences of ss218178027A and ss218178028C to the GeenBee and mFold server. No change in the secondary structure of neither full length mRNA nor 3UTR was observed. It might be assuming that ss218178027A and ss218178028C do not probably modify mRNA processing. Consequently, secondary structure of 3 ´UTR of G6PD mRNA has been also checked for the accessibility of miRNA binding site. A stable base-paired duplex observe in the allele A (figure 4a2) and improper binding for allele G (figure 4b2) (arrows show position of changes). Then, it can be assume that miRNAs can be bind to the target site in mRNA due to the accessible site in the substitution of ss218178024G. Genotype Change in secondary structure Change in secondary of full length of mRNA structure of 3 ´UTR 1311T No ss218178024G Yes Yes 1311T+ ss218178024G Yes ss218178027A No No 1311T + ss218178027A No ss218178028T No No 1311T + ss218178028T No Figure 4 Predicted secondary structures of full length wild-type mRNA (A1) and 3 ´UTR (A2) compare with predicted secondary structures of full length mRNA relating to allele 1311T plus ss218178024G (B1) and 3UTR relating to ss218178024G (B2). The free energy (kcal/mol) of the full-length mRNA and 3UTR is shown in parentheses. Statistical Analysis Discussion A recent systematic study of G6PD deficiency indicated a global prevalence of 4.9% with varying frequencies among different ethnicities (Nkhoma et al. 2009). Although comprehensive studies have identified the molecular basis of G6PD deficiency worldwide, some pertinent questions remain to be addressed. For instance, several studies have reported deficient samples with unknown mutation(s) (Ara ´mbula et al. 2000; Nuchprayoon et al. 2008; Barisic 2005; Laosombat 2005; Pietropertosa 2001; Jiang et al. 2006). Additionally, the silent mutation genotype of C1311T in exon 11 combined with IVS11T93C (G6PD 1311/93) does not explain the phenotype of G6PD deficiency in their carriers. Since there are appears to be no clear linkages to known sequence mutations with these examples, factors extrinsic to the G6PD gene sequence information need to be investigated. These factors may include the roles played by mRNA processing, the untranslated regions (UTRs) and regulatory function by miRNAs. To th e best of our knowledge the importance of mRNA processing and regulation by miRNAs has not been extensively studies with regards to G6PD deficiency. The roles of the UTRs of the G6PD gene have also not received much attention. Our literature search revealed two reports which had evaluated the role of the 3 ´UTR of G6PD gene in their respective deficient population and these reports did not reveal any SNP in the 3 ´UTR for G6PD deficient individuals (Nguyen Thi Hue 2009; Karadsheh 2005). Our present study attempts to shed light on the possible role(s) of the 3UTR of mRNA in G6PD deficiency, especially in the case of G6PD 1311/93. The roles in disease phenotypes played by sequence polymorphisms of the 3 ´UTR have been reported (Lambert et al. 2003; Goto et al. 2001; Yang et al. 2007). Here, we present the possibility that the SNP ss218178024 which we have identified in an AG-rich region of the G6PD 3UTR may participate in mRNA processing and can therefore be correlated with G6PD deficiency. There is, however, accumulating evidence on importance of some elements in the 3UTR like AU-rich, C-rich, CU-rich and AG-rich elements relating to mRNA stability by affecting mRNA secondary structure (SS). For instance, functional SNPs were found to occur within AG-rich elements in some genes like Factor VII (Peyvandi et al. 2005), CYP2A6 gene (Wang et al. 2006), PTPN1 (Di Paola et al. 2002) and NPR1 (Knowles et al. 2003). Therefore, to gain further insights into the role of ss218178024 in G6PD deficiency, we have analyzed the SS of both full length mRNA and 3UTR. Significant alteration was predicted in the SS of full len gth mRNA when we submitted the combination of 1311T and ss218178024G. Whilst in the SS of 3UTR, we observed a possible standard Watson-Crick paired duplex in allele A whereas allele G has a reshuffling of the base pairings resulting in a differing SS prediction for the RNA sequence. The role of structure on RNA function is akin to that of protein. Interestingly, SS of the either full length of mRNA or 3UTR including two substitutions of 1311T and ss218178027A or 1311T and ss218178028C was same with the SS of wild mRNA. This data is good in agree with Chen et al. (2006) which reported that non-functional SNPs in a gene usually have same secondary structure, but the functional SNPs usually change the mRNA secondary structure. Consequently, the free energy is affected by base substitution at ss218178024. In thermo stability point of view, the lower free energy (- 661.6 kcal/mol) in the SS of wild mRNA might be result in a more stable mRNA than mRNA with 1311T and ss218178024G. On the o ther view, SS contributes to interaction of regulatory elements with their target sequence in mRNA. In general, when target sequence is part of a stable base-paired with the other sequence of mRNA, the capacity of regulatory elements like miRNA to get involved in translational regulation could be diminished. Similarly, Hew et al. (2000) have been reported that an AG-rich region in elastin mRNA in chicken may affect mRNA stability and they proposed that alteration in SS in this region can affect the accessibility of endogenous RNse to the mRNA. Therefore, we postulated that miRNA binding site likely is not accessible in the wild mRNA due to its SS. When ss218178024G result in different mRNA SS the miRNA can access the target site as perfect complimentary of seed region is a key to the miRNA regulation. Nevertheless, recent evidence has discovered the significant miRNA expression in erythrocytes which dramatically altered in Sickle cell Disease (ref). Thus, our hypothesis in miRNA reg ulation of G6PD mRNA is reasonable. While, SS is able to modify half life of mRNA, it is also capable to influence interaction of specific sequence of mRNA with regulatory proteins or miRNAs. . Site accessibility is thought to affect the activity of a miRNA binding site. If the secondary structure is such that a potential miRNA binding site is part of a stable base-paired duplex, these bonds will need to be broken before miRNA::mRNA interaction can take place, effectively decreasing the fraction of mRNA molecules of a particular gene which is regulated by a miRNA in question. This could be one of the reasons some of the computational-predicted binding sites are inactive. Here, we demonstrate that a A357G mutation may potentially change the 3 ´UTR secondary structure and create a binding site for hsa-miR-877* affects G6PD expression by either inhibiting mRNA translation or inducing mRNA degradation (Can you explain this bit to me again when we meet). However, we gave evidence for the relevance of the SNP rs3 in G6PD deficiency in G6PD 1311/93 and possible explanation is linkage disequilibrium between this SNP with combination of 1311/93 inside of G6PD gene that might be affect the mRNA translation or stability through miRNA function. In conclusion, to the best of our knowledge, this study reports for the first time an association of a 3 UTR variant of G6PD in a large populations of G6PD 13111/93. However, functional studies are necessary to test this hypothesis. MicroInspector (http://www.imbb.forth.gr/microinspector) (Rusinov et al. 2005) W696-W700 Nucleic Acids Research, 2005, Vol. 33, Web Server issue MicroInspector: a web tool for detection of miRNA binding sites in an RNA sequence Ventsislav Rusinov, Vesselin Baev, Ivan Nikiforov Minkov and Martin Tabler Typically, SNPs occurring in functional genomic regions such as protein coding or regulatory regions are more likely to cause functional distortion and, as such, more likely to underlie disease-causing variations. Current bioinformatics tools examine the functional effects of SNPs only with respect to a single biological function. Therefore, much time and effort is required from researchers to separately use multiple tools and interpret the (often conflicting) predictions. (F-SNP Lee at al) The variant ESR1_rs2747648 affects the miRNA-binding site of miR-453, miR-181(b/d) and miR-219. Due to in silico analysis using miRanda (http://www.microrna.org/microrna/home.do), the variant ESR1_rs2747648 does not significantly effect the binding capacity of miR-219 and miR-181(b/d). However, the binding capacity of miR- 453 is stronger when the C variant allele is present, enabling to bind the complementary G nucleotide of the miR-453 seed. In contrast, the T allele attenuates the binding of miR-453, which we hypothesize to lead to a reduced miRNA-mediated ESR1-repression, in consequence higher ESR1 protein levels and an increased breast cancer risk. Therefore, the breast cancer protective effect observed for the C allele is biologically reasonable. However, functional studies are necessary to test this hypothesis. Due to the fact that endogenous estrogen levels are high premenopausal and drop down post-menopausal, it is plausible that the risk effect of this variant can only be detected in premenopausal women. RNA secondary structure prediction was carried out using the Vienna RNA Package 1.7.2. on the web interface for online RNA folding on the Vienna RNA WebServers.42 The target mRNA prediction was carried out using The microRNA.org resource This is likely because miRNA-mRNA binding is mediated by the RISC complex, and upstream and downstream regions of miRNA binding site may interact with RISC, which mediates miRNA-mRNA binding (26). A polymorphism in the 829C site (SNP-829C3T) is located near the miRNA binding site. 2007 Mishra mirna SNP rs12720208 is located 166 bp downstream of the terminating codon of FGF20 and lies within a predicted binding site for microRNA (miRNA) miR-433. (A) The predicted binding site for miR-433 at 30 UTR of FGF20 gene. At rs12720208, allele C base paired with G in Watson-Crick mode (as shown with a solid line), whereas allele T wobble base paired with G (as shown with a dashed line). ØØ ² Ù†¦Ãƒâ„¢Ã¢â‚¬Å¡ÃƒËœÃƒâ„¢Ã¢â‚¬Å¾Ãƒâ„¢Ã¢â‚¬ ¡ geenbee 2009 capasso Although the mechanism by which interaction of proteins with the G3A sequence might affect message stability remains a matter of speculation, the fact that this sequence is located within a large region of stable secondary structure in the 39-UTR of the elastin mRNA (4) suggests the possibility that RNA/protein interactions at this site may alter the stability of this secondary structure, perhaps affecting the accessibility of endogenous RNases to the mRNA. However, detailed understanding of the mechanism of this process awaits further characterization of the nature of binding protein and the consequences of its interaction with the G3A motif in elastin mRNA. Acknowledgment-We acknowledge GA rich Hew From a physical point of view, we expect that the interaction of a miRNA with its target will depend on the state of the target region prior to interaction. In particular, if the target sequence is already bound (by Watson-Crick base-pairing) to another section of the mRNA chain, this will e_ectively pose a barrier to the base-pairing with the miRNA, and the capacity of such target sequences to mediate translational repression could be diminished. If we were able to predict the accessibility of a potential miRNA binding site, this might improve our target predictions. gi|109132849|AGGGACAGCCCAGAGGA CTGAGCCACCTCCTGCGCTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|108773792| CTGAGTCACCTCCTCCACTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|194680256| CTGAGCCCCCCCCCCCCCACCCCACCGCCCGG-AGCAAGGAAGAGGAGGG ***** * ** ** * * * * * **** ** * * * ******** gi|109132849|AGGGACAGCCCAGAGGA TGCCCATTCGTCTGTCCCAGAGCTTCTCGGTCACTGGGGCTCACTCCTGA gi|108773792| CGCCCATTCGTCTGTCCCAGAGCTTATTGGCCACTGGGTCTCACTCCTGA gi|194680256| CTATAGTTGGGGAAGACAGGGGCAAGGTCCTCAGAAGGCCGAGA ** * * * ** ** ** * ** gi|109132849|AGGGACAGCCCAGAGGA GTGGGGCCTGGGGCAGGAGGGAGGGACGAGGGGGAGGAAAGGGGCGAGCG gi|108773792| GTGGGGCC-AGGGTGGGAGGGAGGGACAAGGGGGAGGAAAGGGGCGAGCA gi|194680256| ATGGGCCCCCTGCACCCCCAGTCTCAGCGCCATTCCACATTCCTGGTC It would be anticipated that increased DHFR reduces MTX cytotoxicity in normal cells while conferring resistance in target cells. A comparison of the human and mouse DHFR 39-UTR sequences revealed that only 100 nucleotides downstream from the terminator codon were conserved between the two species (18). Numerous studies have focused on the effects of coding region variants on P-gp expression and function, whereas few noncoding region variants have been investigated. Mechanisms that alter mRNA levels can change mRNA expression and potentially G6PD activity. Recent evidence has demonstrated that the 3UTR of mRNA is an important regulatory site controlling interactions with mRNA degradation machinery (Hollams et al., 2002; Tourriere et al., 2002; Mangus et al., 2003; Wilkie et al., 2003). 3UTR RNA-binding proteins that recognize specific mRNA sequence elements and secondary structure dictate the fate of mRNA transcripts. Polymorphisms in the 3UTR of G6PD could disrupt RNA-protein interactions, resulting in altered mRNA stability. The stability of mRNA may be altered by 3UTR polymorphisms if recognition of specific mRNA sequence and secondary structure by regulatory proteins is disrupted (Shen et al., 1999; Hollams et al., 2002; Tourriere et al., 2002). A polymorphism in the 3UTR of human tumor necrosis factor-_ changes binding affinity for a multiprotein complex that contains the HuR regulatory protein (Di Marco et al., 2001). HuR binds AG-rich elements in the 3UTR of certain genes (Peng et al., 1998) and has been shown to stabilize mRNA containing tumor necrosis factor-_ 3_-UTR sequence motifs (Dean et al., 2001). There is one report that the 3435C_T synonymous variant decreases mRNA stability (Wang et al., 2005), but to our knowledge no pharmacogenetic research of this type has been conducted for ABCB1 3_-UTR variants. Thus, our mRNA half-life data represent novel findings as to the effects the _89A_T, _146G_A, and _193A_G polymorphisms have on ABCB1 mRNA stability and demonstrate the utility of using stable cell lines made with Flp-In technology for these measurements. Similarly