Critique of a Political Speech Essay Example | Topics and Well Written Essays - 1000 words

Critique of a Political Speech - Essay Example For the first appeal, or Ethos, it is usually utilized for the description of the speaker’s credibility or authority in the subject he is talking on. It presents the questions, what authority does the speaker to talk on the topic or â€Å"is the speaker knowledgeable enough?† Ethos also pertains to the charisma of the speaker, on whether he has captured or garnered the respect of his audience for them to listen to what he has to convey. In the speech of Obama, it is clear that the element or appeal of Ethos is present. Since it is Obama’s inaugural speech as the 44th President of the United States, he obviously has the authority, charisma, and trust of the audience. In his speech, he reminds the audience of his inauguration as the 44th President of the United States, offers his thanks and gratefulness for his victory and at the same time, and recognizes the enormous responsibility he is to undertake from his predecessors. Typical to many political speeches, ethos is established during the introduction where a speaker attempts to garner the trust and confidence of his audience. He posits in the initial paragraphs of his Inaugural speech, â€Å"Forty-four Americans have now taken the presidential oath. The words have been spoken during rising tides of prosperity and the still waters of peace. Yet, every so often the oath is taken amidst gathering clouds and raging storms. At these moments, America has carried on not simply because of the skill or vision of those in high office, but because We the People have remained faithful to the ideals of our forbearers, and true to our founding documents.† What can be appreciated from Obama’s speech with regard to ethos would be that Obama presented his authority and charisma in a very humble manner. He did not appear to boast that he is now the latest President of the United States, but instead conveyed an aura of humility. He begins by saying, â€Å"My fellow citizens†, where he at tempts to present himself as another ordinary American citizen, and he again mentions, â€Å"I stand here today humbled by the task before us, grateful for the trust you have bestowed, mindful of the sacrifices borne by our ancestors.† Obama even sought to praise the achievements of then-President George W. Bush, which would have to a certain extent, healed wounded political scars in the recent elections. He stated, â€Å"I thank President Bush for his service to our nation, as well as the generosity and cooperation he has shown throughout this transition.† For the second appeal, Logos, it is the employment of reason and logic to persuade the audience. Through the use of facts, statistics, and researches as evidence, the speaker convinces the audience of the truth and validity of his claim. As expected of a prominent lawyer, a former Senator, and the new President of the United States, Obama is well-informed, well-researched, and well-versed with political developments . In his speech, Obama presents the current problems of the United States. He states in paragraph 4, â€Å"That we are in the midst of crisis is now well understood. Our nation is at war, against a far-reaching network of violence and hatred. Our economy is badly weakened, a consequence of greed and irresponsibility on the part of some, but also our collective failure to make hard choices and prepare the nation for a new age. Homes have been lost; jobs shed; businesses shuttered. Our

Phuket Beach Analysis Essay Example for Free

Phuket Beach Analysis Essay Statement of the Problem Should the management of Phuket Beach Resort accept the offer made by PlanetKaraoke Pub to set up an outlet inside the hotel or should the managementoperate a pub, Beach Karaoke Pub, by itself? II. Case Background Mike Campbell, General Manager of Phuket Beach Hotel is considering an offermade by Planet Karaoke Pub, a fast expanding company, which is looking for avenue in Patong beach area for setting up another outlet. The Board of Directorsof the establishment had previously rejected several old offers because it offerslow return on investment. The space was located on the second floor of the main building and was verymuch under-utilised. Planat Karaoke Pub offered to sign a four-year leaseagreement with the hotel for rending part of the unused space. It proposed topay:a. a monthly rental fee of 170,000 baht for the first two years; andb. thereafter, a 5% increment for the next two years. Planet Karaoke Pub required only 70% of the unused space measuring 3,000 sq. feet. This would allow the hotel to keep the remaining space for the creation of analley two years later. Mike Campbell is contemplating on creating a pub operated by the managementof the hotel itself since such establishments attract a lot of customers andtourists. Mike Campbell sought the assistance of Kornkrit Manming, the hotel’s FinancialController to review the offer from Planet Karaoke Pub and estimating revenuesand costs associated with an alternative project, Beach Karaoke Pub. III. Objectives With the given two alternatives on hand, this case aims to:a. ome up with a concrete recommendation to the board of directorsof Phuket Beach Resort of which of the two alternatives will offer a higherreturn on investmentb. determine if operating a pub in the hotel, whether by a third party orby management, will be a good investment on the part of the hotel. c. compute for the relevant cashflows associated with each projects? The 25% fear factor is applied on the projected annual net room revenuerepresenting 50% of the pub revenue – 50% from hotel guests. . Overhead expenses allocated to the Planet Karaoke Pub project amountingto 55,000 baht and 16% of sales representing salaries for the Beach KaraokePub project are considered irrelevant costs since these costs will not differbetween alternatives. Both are allocated costs. 5. The weighted average cost of capital is 10. 75% computed using 10%interest rate and 12% hotel owners’ cost of equity on its capital structureconsisting of 25% debt and 75% equity respectively. The cost of equity isassumed to be after tax. 6. All payments and inflows assumed to have been made at the end of theyear. The two projects have unequal lives: Planet Karaoke Pub to run for 4 yearswhile Beach Karaoke Pub to run for 6 years. 8. It was envisaged that the proposed pub would not affect the hotel’s futureexpansion plans. 9. The existing system ranked projects according to their average return oninvestment and payback period, regardless to the time value of money. 10. Similar development proposals had been rejected by the board because itrequired a long payback period. Other proposals were also discarded due toits low return on investment.

A Silent Mutation With Unknown Mechanism Biology Essay

A Silent Mutation With Unknown Mechanism Biology Essay A silent mutation with unknown mechanism of C1311T in exon 11 combined with IVS11 T93C (G6PD 1311/93) has been reported in G6PD deficient individuals in many populations. In our previous study, G6PD 1311/93 was identified as the common G6PD variant in one of the Malaysian aboriginal groups. Here, we report the screening for this variant via PCR-RFLP method and then direct sequencing of the entire 3 ´UTR of the G6PD gene in 175 aboriginal volunteers and 45 non-aboriginals. In the aboriginal group, 72 individuals (41%) carried the G6PD 1311/93 while 6 individuals (13%) were identified in the non-aboriginal set. Three novel SNPs, ss218178027 (+272 G/A), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) were discovered in 3 ´UTR. SNP ss218178024, which is located inside an AG-rich region, has shown a significant association with G6PD 1311/93 as it was observed solely in individuals with G6PD 1311/93. Computational analyses indicated that three miRNAs have potential to bind to the reg ions encompassing ss218178024. Whilst transitions of A to G dose not destroy these miRNA target sites, it extensively alters the mRNA secondary structure and creates a putative hsa-miR-877* binding site. Notably, ss218178027 and ss218178028 do not change mRNA secondary structure. It could be speculated that ss218178024 have a potential functional effect on the down-regulation of mRNA and consequently G6PD deficiency either by affecting mRNA secondary structure or mirRNA regulation process. This is the first report of clinical association of a SNP in 3 ´UTR of G6PD mRNA. Genetic variations in the G6PD gene are responsible for G6PD deficiency in humans. More than 140 ethnic reliant nucleotide variations in the G6PD gene have been reported (Nkhoma et al 2009). Most of these variants are single missense mutations, with the rest being either double or triple missense mutations or small in frame deletions (Cappellini, G Fiorelli 2008). All these mutations alter the protein sequence of the G6PD enzyme by either amino acid substitution except for a silent mutation of C1311T in exon 11 combined with IVS11T93C (designated here as G6PD 1311/93). This genotype has been reported in G6PD deficient individuals in different ethnic populations with different frequency (Vulliamy et al. 1991; 2000; Jiang et al. 2006; Daoud et al. 2008; Jalloh et al. 2008; Wang et al. 2008; Moiz et al. 2009 ). This combination is a special G6PD variant where the carrier is deficient without any changes to the protein sequence of the G6PD enzyme. From previous studies, association of th ese two has been shown as significant in reducing G6PD enzyme activity in some individuals and hence has clinical implications (Yu et al 2004; Wang et al 2008; Jiang et al 2006). It is notable that some of the individuals with G6PD 1311/93 presented with normal G6PD activity (Jiang et al 2006). Bearing in mind, it is reasonable to postulate that other change(s) in the G6PD gene with potential linkage disequilibrium by this combination is responsible for the enzyme deficiency. Importance of 3 ´UTR of human genes in the post-transcriptional regulation has been supported by finding of functional SNPs in the 3 ´UTR of a number of genes (ref). In the other word, genetic variations in the 3 ´UTR of some genes are associated with variety of human disease ( ref ). Cis-acting elements in the 3 ´UTR of human genes are key players in controlling of mRNA stability, localization and level of translation (ref). Conversely, according to a recent systematic search, 106 conserved motifs located in the 3 ´UTR of human gene are associated with post-transcriptional regulation which half of them likely are miRNA binding sites (Xie et al 2005). MicroRNAs (miRNAs) are a class of genes encoding short RNAs, which are known to inhibit gene expression by binding to the 3 ´UTR of the target transcript. Notably, miRNAs are predicted to regulate about 30% of all human genes by targeting sequences in their 3 ´UTR (ref) . Noteworthy, several SNPs inside the miRNA gene and the miRNA binding sites have been identified recently (ref). The associations of these SNPs with some disease like Parkinson and some kind of cancer have been documented (Sethupathy 2008; Shen 2008). Given that, in the present study, we sought to determine if any SNP in the 3 ´UTR of G6PD gene in G6PD 1311/93 is involve in the regulation of mRNA processing. Subjects and Methods This study was approved by the University Kebangsaan Malaysia (UKM) hospitals ethics committee. All subjects gave their written informed consent. In our previous study, we attempted to identify the molecular basis of G6PD deficiency in 25 deficient individuals from one of the Malaysia aborigine group, namely, the Negrito (data in press). Our earlier results showed that G6PD 1311/93 is the commonest G6PD variant in Negrito. No other mutations were detected in the remaining exons or adjacent regions of the G6PD gene for subjects with G6PD 1311/93. In the present study, blood was collected from 175 consenting volunteers from four sub-ethnic groups of Negrito namely Kintak, Lanoh, Jahai, and Bateq. A series of 45 non-aboriginal volunteers were selected as the reference group. Genomic DNA was extracted by using the Salting Out method (ref). The oligonucleotides used as primers were either designed by online primer-BLAST program or obtained from published data (Kurdi-Haidar et al. 1990). The G6PD gene sequence was obtained from NCBI (reference sequence NC_000023.9). Sequence of each exon was obtained from ENSEMBL (Transcript ENST000 00393562). Then two regions of the G6PD gene (region ab and cd in figure 1) were amplified using the PCR technique to detect variation in nt 1311 in exon 11and nt 93 in intron 11. A proportion of the PCR product from regions ab (207 bp) and cd (317 bp) were digested with the appropriate restriction enzyme according to the manufacturers instructions (New England Biolabs) and then run on 3% agarose gels, stained with ethidium bromide, and photographed under UV light. Region ab was digested with BclI and region cd was digested with NlaIII. For all samples, PCR direct sequencing was performed for 3 ´ UTR of G6PD gene by using 2 sets primer of ef (320 bp) and gh (397 bp). Figure 1: Schematic map of part of G6PD gene (exon 10 to exon 13). The arrows point to the positions of each primer site. Oligonucleotides a: 5 AAGACGTCCAGGATGAGGTGATC 3 and b: 5 TGTTCTTCAACCCCG AGGAGT 3 are the primers used to detect 1311 C>T transition. Oligonucleotides c: 5 TGGCATCAGCAAGACACTCTCTC 3 and d: 5 CCCTTTCCTCACCTG CCATAAA3 are the primers used to detect IVS11 nt93 T>C. Oligonucleotides e: 5 GAGCCCTGG GCACCCACCTC 3 and f : 5 TCTGTTGGGCTGGAGTGA 3 were amplified part of 3UTR and oligonucleotides g (5TCACTCCAGCCCAACAGA3) and h (5 GGTCCTCAG GGAAGCAAA 3) were amplified the rest of 3UTR of G6PD gene for sequencing. Bioinformatic Tools We used two computational tools for each section to confirm our results. F-SNP (http://compbio.cs. queensu.ca/F-SNP/) (Lee Shatkay 2008) and FASTSNP (http://fastsnp.ibms.sinica.edu.tw) (Yuan et al. 2006) was used to find putative functional SNP in 3 ´UTR of G6PD gene. The RegRNA program (http://regrna.mbc.nctu.edu.tw/) (Huang et al. 2006) and MicroInspector (http://bioinfo. uni-plovdiv.bg/microinspector/) (Rusinov et al. 2005) was utilized to identify the miRNAs binding sites inside 3 ´UTR of G6PD gene. Secondary structures of the full-length of G6PD mRNA and as well, 3 ´UTR was predicted using GeneBee (http://www.genebee.msu.su/genebee.html) and mFold (http://mobyle.pasteur.fr/cgi-bin/portal.py) (Zuker et al. 1999). The program RNAhybrid (http://bibiserv. techfak.uni-bielefeld.de/cgi-bin/rnafold_submit) (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy hybridisation of mRNA and miRNA. Results Genotyping DNA from 175 aboriginals and 45 non-aboriginals were screened for presence of G6PD 1311/93. In overall 72 aboriginal individuals (41%) and 6 non-aboriginal subjects (13%) carried this combination (table 1). Through direct sequencing of DNA fragments, three novel SNPs, of ss218178027 (+272 A/G), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) was found (Figure 2). SNP ss218178027 was observed in 6 subjects in aboriginal group with G6PD 1311/93 (table 1) inside of an AG-rich region (AGAAGGAAGGAGGAGG). SNP ss218178028 was observed in 4 aboriginal individuals which 3 of them carried normal alleles in 1311 and 93. None of our non-aboriginal samples carried ss218178027 or ss218178028. SNP ss218178024 also surrounds by other 30 bp AG-rich sequence (gggagggagggacaag ggggaggaaagggg) and it was observed in all those G6PD deficient individuals who carried G6PD 1311/93. In the absence of G6PD 1311/93, ss218178024 was not found. Females who were heterozygote for the G6PD 1311/93 were also heter ozygote for ss218178024. Figure 2. Partial nucleotide sequence of normal, heterozygote and homozygote females respectively for forward strand of ss218178024 (a1, a2, a3), reverse strand of ss218178027 (b1, b2, b3) and reverse strand of ss218178028 (c1, c2,c3). Arrows show position of each SNP. Table 2 SNP Individuals with G6PD 1311/93 individuals normal for G6PD 1311/93 ss218178024 ss218178027 ss218178028 Aboriginal individual 72 105 72 6 4 Non-aboriginal individual 6 37 6 0 0 Bioinformatics Analysis Search for reported SNPs inside of 3 ´UTR of G6PD gene By using F-SNP and FASTSNP programs, we found six SNPs have been reported inside of 3 ´UTR of G6PD gene including SNP ref ID: rs1050831,  rs1050774, rs1050773, rs1050830, rs1063529, rs1050757.  The last one is actually same with ss218178024. All of these known SNPs were discovered via cDNA sequencing and to date no clinical associations have been reported for them. Prediction of putative miRNA binding sites and mRNA secondary structure The wild sequence of 3UTR of G6PD was submitted to regRNA and MicroInspector programs to detect putative miRNAs target sites. The mutant variant of ss218178024, ss218178027 and ss218178028 was also submitted to evaluate effect of each SNP on creating or destroying the miRNAs target sites. However, in silico analysis indicated that three miRNAs have potential to bind to the regions encompassing ss218178024A. Of note, SNP ss218178024 is located inside seed region of these miRNAs which are hsa-mir-204, hsa-mir-211 and has-mir-1249 (figure 3). Moreover, further computational analyses reveal that transition of A to G in SNP ss218178024 creates additional miRNA target site for has- miR-877* which also is located inside seed region. Neither ss218178027 nor ss218178028 is targeted by any miRNA. The RNAhybrid program (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy (MFE) hybridisation of mRNA and each miRNA. Figure 3 The predicted binding site for hsa-mir-211(A), hsa-miR-1249 (B), hsa- mir-204 (C) and hsa-miR-877* (D) at 3 ´UTR of G6PD gene. Perfect Watson-Crick or wobble base pairings between the 5 ´ end of the miRNA and the 3à ¢Ã¢â€š ¬Ã‚ ² UTR target sites was observed. The minimum free energy (kcal/mol) of hybridization is shown in parentheses. Position of ss218178024G is indicated by arrows. Using the program mFold and Genebee, we determined the potential effect of the SNP sequence alterations on RNA folding. As shown in figure 4, ss218178024G is predicted to alter the secondary structure of G6PD mRNA. Also, the free energy of full length mRNA and as well 3UTR predicted to be affected by this substitution. The lower free energy in wild type indicates that mRNA might be more stable in wild type compare with the mutant. In the other word, it is suggesting that altered mRNA is capable to faster degradation. We also submitted the substituted nucleotide sequences of ss218178027A and ss218178028C to the GeenBee and mFold server. No change in the secondary structure of neither full length mRNA nor 3UTR was observed. It might be assuming that ss218178027A and ss218178028C do not probably modify mRNA processing. Consequently, secondary structure of 3 ´UTR of G6PD mRNA has been also checked for the accessibility of miRNA binding site. A stable base-paired duplex observe in the allele A (figure 4a2) and improper binding for allele G (figure 4b2) (arrows show position of changes). Then, it can be assume that miRNAs can be bind to the target site in mRNA due to the accessible site in the substitution of ss218178024G. Genotype Change in secondary structure Change in secondary of full length of mRNA structure of 3 ´UTR 1311T No ss218178024G Yes Yes 1311T+ ss218178024G Yes ss218178027A No No 1311T + ss218178027A No ss218178028T No No 1311T + ss218178028T No Figure 4 Predicted secondary structures of full length wild-type mRNA (A1) and 3 ´UTR (A2) compare with predicted secondary structures of full length mRNA relating to allele 1311T plus ss218178024G (B1) and 3UTR relating to ss218178024G (B2). The free energy (kcal/mol) of the full-length mRNA and 3UTR is shown in parentheses. Statistical Analysis Discussion A recent systematic study of G6PD deficiency indicated a global prevalence of 4.9% with varying frequencies among different ethnicities (Nkhoma et al. 2009). Although comprehensive studies have identified the molecular basis of G6PD deficiency worldwide, some pertinent questions remain to be addressed. For instance, several studies have reported deficient samples with unknown mutation(s) (Ara ´mbula et al. 2000; Nuchprayoon et al. 2008; Barisic 2005; Laosombat 2005; Pietropertosa 2001; Jiang et al. 2006). Additionally, the silent mutation genotype of C1311T in exon 11 combined with IVS11T93C (G6PD 1311/93) does not explain the phenotype of G6PD deficiency in their carriers. Since there are appears to be no clear linkages to known sequence mutations with these examples, factors extrinsic to the G6PD gene sequence information need to be investigated. These factors may include the roles played by mRNA processing, the untranslated regions (UTRs) and regulatory function by miRNAs. To th e best of our knowledge the importance of mRNA processing and regulation by miRNAs has not been extensively studies with regards to G6PD deficiency. The roles of the UTRs of the G6PD gene have also not received much attention. Our literature search revealed two reports which had evaluated the role of the 3 ´UTR of G6PD gene in their respective deficient population and these reports did not reveal any SNP in the 3 ´UTR for G6PD deficient individuals (Nguyen Thi Hue 2009; Karadsheh 2005). Our present study attempts to shed light on the possible role(s) of the 3UTR of mRNA in G6PD deficiency, especially in the case of G6PD 1311/93. The roles in disease phenotypes played by sequence polymorphisms of the 3 ´UTR have been reported (Lambert et al. 2003; Goto et al. 2001; Yang et al. 2007). Here, we present the possibility that the SNP ss218178024 which we have identified in an AG-rich region of the G6PD 3UTR may participate in mRNA processing and can therefore be correlated with G6PD deficiency. There is, however, accumulating evidence on importance of some elements in the 3UTR like AU-rich, C-rich, CU-rich and AG-rich elements relating to mRNA stability by affecting mRNA secondary structure (SS). For instance, functional SNPs were found to occur within AG-rich elements in some genes like Factor VII (Peyvandi et al. 2005), CYP2A6 gene (Wang et al. 2006), PTPN1 (Di Paola et al. 2002) and NPR1 (Knowles et al. 2003). Therefore, to gain further insights into the role of ss218178024 in G6PD deficiency, we have analyzed the SS of both full length mRNA and 3UTR. Significant alteration was predicted in the SS of full len gth mRNA when we submitted the combination of 1311T and ss218178024G. Whilst in the SS of 3UTR, we observed a possible standard Watson-Crick paired duplex in allele A whereas allele G has a reshuffling of the base pairings resulting in a differing SS prediction for the RNA sequence. The role of structure on RNA function is akin to that of protein. Interestingly, SS of the either full length of mRNA or 3UTR including two substitutions of 1311T and ss218178027A or 1311T and ss218178028C was same with the SS of wild mRNA. This data is good in agree with Chen et al. (2006) which reported that non-functional SNPs in a gene usually have same secondary structure, but the functional SNPs usually change the mRNA secondary structure. Consequently, the free energy is affected by base substitution at ss218178024. In thermo stability point of view, the lower free energy (- 661.6 kcal/mol) in the SS of wild mRNA might be result in a more stable mRNA than mRNA with 1311T and ss218178024G. On the o ther view, SS contributes to interaction of regulatory elements with their target sequence in mRNA. In general, when target sequence is part of a stable base-paired with the other sequence of mRNA, the capacity of regulatory elements like miRNA to get involved in translational regulation could be diminished. Similarly, Hew et al. (2000) have been reported that an AG-rich region in elastin mRNA in chicken may affect mRNA stability and they proposed that alteration in SS in this region can affect the accessibility of endogenous RNse to the mRNA. Therefore, we postulated that miRNA binding site likely is not accessible in the wild mRNA due to its SS. When ss218178024G result in different mRNA SS the miRNA can access the target site as perfect complimentary of seed region is a key to the miRNA regulation. Nevertheless, recent evidence has discovered the significant miRNA expression in erythrocytes which dramatically altered in Sickle cell Disease (ref). Thus, our hypothesis in miRNA reg ulation of G6PD mRNA is reasonable. While, SS is able to modify half life of mRNA, it is also capable to influence interaction of specific sequence of mRNA with regulatory proteins or miRNAs. . Site accessibility is thought to affect the activity of a miRNA binding site. If the secondary structure is such that a potential miRNA binding site is part of a stable base-paired duplex, these bonds will need to be broken before miRNA::mRNA interaction can take place, effectively decreasing the fraction of mRNA molecules of a particular gene which is regulated by a miRNA in question. This could be one of the reasons some of the computational-predicted binding sites are inactive. Here, we demonstrate that a A357G mutation may potentially change the 3 ´UTR secondary structure and create a binding site for hsa-miR-877* affects G6PD expression by either inhibiting mRNA translation or inducing mRNA degradation (Can you explain this bit to me again when we meet). However, we gave evidence for the relevance of the SNP rs3 in G6PD deficiency in G6PD 1311/93 and possible explanation is linkage disequilibrium between this SNP with combination of 1311/93 inside of G6PD gene that might be affect the mRNA translation or stability through miRNA function. In conclusion, to the best of our knowledge, this study reports for the first time an association of a 3 UTR variant of G6PD in a large populations of G6PD 13111/93. However, functional studies are necessary to test this hypothesis. MicroInspector (http://www.imbb.forth.gr/microinspector) (Rusinov et al. 2005) W696-W700 Nucleic Acids Research, 2005, Vol. 33, Web Server issue MicroInspector: a web tool for detection of miRNA binding sites in an RNA sequence Ventsislav Rusinov, Vesselin Baev, Ivan Nikiforov Minkov and Martin Tabler Typically, SNPs occurring in functional genomic regions such as protein coding or regulatory regions are more likely to cause functional distortion and, as such, more likely to underlie disease-causing variations. Current bioinformatics tools examine the functional effects of SNPs only with respect to a single biological function. Therefore, much time and effort is required from researchers to separately use multiple tools and interpret the (often conflicting) predictions. (F-SNP Lee at al) The variant ESR1_rs2747648 affects the miRNA-binding site of miR-453, miR-181(b/d) and miR-219. Due to in silico analysis using miRanda (http://www.microrna.org/microrna/home.do), the variant ESR1_rs2747648 does not significantly effect the binding capacity of miR-219 and miR-181(b/d). However, the binding capacity of miR- 453 is stronger when the C variant allele is present, enabling to bind the complementary G nucleotide of the miR-453 seed. In contrast, the T allele attenuates the binding of miR-453, which we hypothesize to lead to a reduced miRNA-mediated ESR1-repression, in consequence higher ESR1 protein levels and an increased breast cancer risk. Therefore, the breast cancer protective effect observed for the C allele is biologically reasonable. However, functional studies are necessary to test this hypothesis. Due to the fact that endogenous estrogen levels are high premenopausal and drop down post-menopausal, it is plausible that the risk effect of this variant can only be detected in premenopausal women. RNA secondary structure prediction was carried out using the Vienna RNA Package 1.7.2. on the web interface for online RNA folding on the Vienna RNA WebServers.42 The target mRNA prediction was carried out using The microRNA.org resource This is likely because miRNA-mRNA binding is mediated by the RISC complex, and upstream and downstream regions of miRNA binding site may interact with RISC, which mediates miRNA-mRNA binding (26). A polymorphism in the 829C site (SNP-829C3T) is located near the miRNA binding site. 2007 Mishra mirna SNP rs12720208 is located 166 bp downstream of the terminating codon of FGF20 and lies within a predicted binding site for microRNA (miRNA) miR-433. (A) The predicted binding site for miR-433 at 30 UTR of FGF20 gene. At rs12720208, allele C base paired with G in Watson-Crick mode (as shown with a solid line), whereas allele T wobble base paired with G (as shown with a dashed line). ØØ ² Ù†¦Ãƒâ„¢Ã¢â‚¬Å¡ÃƒËœÃƒâ„¢Ã¢â‚¬Å¾Ãƒâ„¢Ã¢â‚¬ ¡ geenbee 2009 capasso Although the mechanism by which interaction of proteins with the G3A sequence might affect message stability remains a matter of speculation, the fact that this sequence is located within a large region of stable secondary structure in the 39-UTR of the elastin mRNA (4) suggests the possibility that RNA/protein interactions at this site may alter the stability of this secondary structure, perhaps affecting the accessibility of endogenous RNases to the mRNA. However, detailed understanding of the mechanism of this process awaits further characterization of the nature of binding protein and the consequences of its interaction with the G3A motif in elastin mRNA. Acknowledgment-We acknowledge GA rich Hew From a physical point of view, we expect that the interaction of a miRNA with its target will depend on the state of the target region prior to interaction. In particular, if the target sequence is already bound (by Watson-Crick base-pairing) to another section of the mRNA chain, this will e_ectively pose a barrier to the base-pairing with the miRNA, and the capacity of such target sequences to mediate translational repression could be diminished. If we were able to predict the accessibility of a potential miRNA binding site, this might improve our target predictions. gi|109132849|AGGGACAGCCCAGAGGA CTGAGCCACCTCCTGCGCTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|108773792| CTGAGTCACCTCCTCCACTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|194680256| CTGAGCCCCCCCCCCCCCACCCCACCGCCCGG-AGCAAGGAAGAGGAGGG ***** * ** ** * * * * * **** ** * * * ******** gi|109132849|AGGGACAGCCCAGAGGA TGCCCATTCGTCTGTCCCAGAGCTTCTCGGTCACTGGGGCTCACTCCTGA gi|108773792| CGCCCATTCGTCTGTCCCAGAGCTTATTGGCCACTGGGTCTCACTCCTGA gi|194680256| CTATAGTTGGGGAAGACAGGGGCAAGGTCCTCAGAAGGCCGAGA ** * * * ** ** ** * ** gi|109132849|AGGGACAGCCCAGAGGA GTGGGGCCTGGGGCAGGAGGGAGGGACGAGGGGGAGGAAAGGGGCGAGCG gi|108773792| GTGGGGCC-AGGGTGGGAGGGAGGGACAAGGGGGAGGAAAGGGGCGAGCA gi|194680256| ATGGGCCCCCTGCACCCCCAGTCTCAGCGCCATTCCACATTCCTGGTC It would be anticipated that increased DHFR reduces MTX cytotoxicity in normal cells while conferring resistance in target cells. A comparison of the human and mouse DHFR 39-UTR sequences revealed that only 100 nucleotides downstream from the terminator codon were conserved between the two species (18). Numerous studies have focused on the effects of coding region variants on P-gp expression and function, whereas few noncoding region variants have been investigated. Mechanisms that alter mRNA levels can change mRNA expression and potentially G6PD activity. Recent evidence has demonstrated that the 3UTR of mRNA is an important regulatory site controlling interactions with mRNA degradation machinery (Hollams et al., 2002; Tourriere et al., 2002; Mangus et al., 2003; Wilkie et al., 2003). 3UTR RNA-binding proteins that recognize specific mRNA sequence elements and secondary structure dictate the fate of mRNA transcripts. Polymorphisms in the 3UTR of G6PD could disrupt RNA-protein interactions, resulting in altered mRNA stability. The stability of mRNA may be altered by 3UTR polymorphisms if recognition of specific mRNA sequence and secondary structure by regulatory proteins is disrupted (Shen et al., 1999; Hollams et al., 2002; Tourriere et al., 2002). A polymorphism in the 3UTR of human tumor necrosis factor-_ changes binding affinity for a multiprotein complex that contains the HuR regulatory protein (Di Marco et al., 2001). HuR binds AG-rich elements in the 3UTR of certain genes (Peng et al., 1998) and has been shown to stabilize mRNA containing tumor necrosis factor-_ 3_-UTR sequence motifs (Dean et al., 2001). There is one report that the 3435C_T synonymous variant decreases mRNA stability (Wang et al., 2005), but to our knowledge no pharmacogenetic research of this type has been conducted for ABCB1 3_-UTR variants. Thus, our mRNA half-life data represent novel findings as to the effects the _89A_T, _146G_A, and _193A_G polymorphisms have on ABCB1 mRNA stability and demonstrate the utility of using stable cell lines made with Flp-In technology for these measurements. Similarly

Safe Distances :: Personal Narrative Religion Papers

Safe Distances Evolution at its most basic is the process by which a species puts barriers between itself and extinction. Anytime a species finds a way to increase its individual organisms' ability to reproduce, it has put a little extra distance between the species and total annihilation. For example: the peacock's elaborate tail, which ensures his success in propagating his genes, also makes him an easy catch for predators. One might imagine that the peacock could simply have invested in a foreign sports car to attract the opposite sex. I was 15 the first time I made my own blood run. I was sitting in the crowded closet, feeling that iron-in-my-stomach sensation that had been with me more and more since my grandmother had died, since my father had started screaming so much, since my feelings for school had gone from run of the mill adolescent angst to extreme boredom, frustration, outrage over the absurdity of it all. I would sit some nights like a toddler in the darkness of my closet, morosely rehashing my grievances against life, lost in a forest of sweaters and skirts. I would brood, and think and will myself not to cry until the effort became too great and I'd give in and wring my hands and rain tears on my sneakers and sandals and sensible dress shoes in silence until the iron had dissolved enough that I could stand straight again. The Hebrew's relationship with God starts out as extremely simple and extremely personal. God chooses his favorites with frightening randomness, picking otherwise unremarkable second sons to succeed their morally ambiguous, but also chosen, fathers. God's actions in Genesis are often inexplicably random, even petty. God forbids his first human creation to eat a certain apple, and then puts a whole tree full of the forbidden fruit right in front of them. When they finally give in and taste test what they shouldn't have, Adam and Eve are banished from paradise and consigned to death. God's actions here seem cruel and unfair, or at the very least, unfathomable to human minds. We can't help but feel a little outrage and confusion over the events of Genesis. Why wasn't Lot's wife allowed to look back (19:26)? Why did God just up and slay Er (38:7)? How could Cain be allowed to live after killing his brother (4:15), when God was willing to kill all the children on earth with one gigantic flood in order to cleanse the earth of sin (6:13)?

Compare How Cultural Differences and Foreign Business Environments Affect Multinational Corporations

M2-Compare how cultural differences and foreign business environments affect multinational corporations In this report I will be stating the differences of how Tesco function in South Korea compared to how they function in the United Kingdom. Tesco have to adapt to the local culture, traditions and tastes and have to recreate an environment in which shoppers will feel at home. Tesco’s local adaption strategy in South Korea involves selling products and services based not on the UK experience, but on Korean customer demand.Tesco in South Korea provides live octopus, pet iguanas, fish chopped up alive sushi-style, and dental services as a way of their adaption strategy to appeal to South Korean’s culture. Hofstede’s Uncertainty Avoidance (UA) theory, states deals with the degree to which members of a particular society feel uncomfortable with uncertainty. The theory relates to the fact that the future can never be known. Countries that exhibit strong UA , such as S outh Korea, maintain strict codes of belief and behaviour. They are intolerant of unorthodox ideas.By adopting the approach Tesco have chosen, they are allowing for a society such as South Korea’s to be more welcoming to the arrival of the company, which in turn invites a greater scope of custom. Tesco was helped in developing this approach by entering the market through a joint venture with Samsung, a powerful brand name in its own right and one of the leading conglomerates in South Korea. This will help build the recognition for Tesco in South Korea and build a relationship with new customers. As per the Hofstede theory referred to earlier, Samsung represents safety and security within the South Korean market.Therefore, UA is likely to be severely reduced when partnered with such an established brand within the target community. The localised approach means a lot more fresh food than in the UK to recreate a market atmosphere, as well as fast food outlets, coffee shops and t oddler play areas. However, the Tesco home stores in South Korea have been located as ‘culture centres’ where mothers and customers can take classes; learn new skills and have access to the internet cafe. This is because Tesco are aware that the majority of South Korean mothers prefer to look after their children rather than work.Having this available will attract more customers and help be more suitable for South Korean customers. Overall the Tesco in South Korea’s aim is to create value to build and retain store feminism and collectivism. Tesco in South Korea generally sell products that will appeal to South Korean customers, which will include branded products and live animals including fish and octopus. As South Koreans are recognised as not having a great deal of time to shop due to heavy workloads, they employ a scan system.This allows customers to scan products off posters on their phones, so they can get the products delivered to them by the time they are home from work. The posters mainly appear in train stations, as this will get the most usage via people travelling to and from work. Tesco use many strategies to adapt to the culture they are working in, which will encourage more customers to shop from their and beat their local competitors. However, Tesco in the UK provide many different products to appeal to different ethnicities and cultures including their own branded food.Tesco operates differently in both South Korea and the UK as both countries are very different. However they have the same aim, which is to create value, to build loyalty among their customers. Tesco in South Korea has a very different infrastructure compared with the UK, as in South Korea they offer the scan system. This is very different to the UK because they have many Tesco supermarkets; many being 24 hours where customers can go to buy their products. They do also offer online shopping, where they can place their order online and get it delivered.Also in the UK they have self-scanner which has become very popular and other big branded supermarkets are now using. This is where customers scan their products and make the payment by themselves. To conclude, after conducting research on how Tesco functions in both South Korea and the UK, there are many more differences than similarities. Due to the different cultures, Tesco have to adapt their shop to reach the needs of the customer, so their strategies are very different in each country. Tesco is a successful company and due to the changes they make to adapt to different cultures it has made them a well-known international brand.D2-Evaluate the impact of cultural differences on international business performance in the market In this report I will be evaluating the impact of cultural differences on international business performance in the market. This includes evaluating the strategies Tesco use in both South Korea and the UK, which are very different. If Tesco did not adapt their str ategies in different countries they wouldn’t fit in with their cultures, therefore people will be less likely to shop there. Tesco need to provide certain foods that will appeal to the country they are in.For example, Tesco in South Korea have branded products, and a lot of meat including octopus and sushi-like fish. Tesco in the UK provide products for wide range of cultures and offer many branded foods including Tesco’s own. If Tesco did not adapt to different cultures they could lose out on business and potential customers might go to their local competitors. This may also give Tesco a bad reputation for their supermarket, and their recognition as a company could be negative. Going into a new market can be difficult due to the local competitors and getting people to change where they currently shop.If Tesco did not come up with such unique ideas in South Korea, they wouldn’t get the customers they do today, and they would struggle to make enough money to keep a Tesco running there. However, due to such unique ideas that local competitors do not offer, they are a very well-known international brand. In the UK Tesco have three other main supermarkets that they have to compete with; Asda, Morrison’s, and Sainsbury’s. Surrounded by such strong competitors, Tesco are always thinking of new strategies to gain more recognition and greater market share than their rivals.Tesco offer a Clubcard; which is where customers can collect points from the products they purchase. These Clubcard points will allow customers to get money off future shops, and receive vouchers after saving up a certain amount. In South Korea Tesco have established their way of life and learnt to adapt their strategies to appeal in South Korea. Tesco have had to undertake much research, in order to find out more about South Korea. It is regarded as the second hardest working country in the world, which means that many people do not have time to go food shopping.T esco have thought of a solution which is for customers to shop at Tesco, and get their food delivered to them. If Tesco did not offer such a unique strategy it would be hard to get people to change where they get their food from. However, this appeals to many people in South Korea, and therefore Tesco have become a very successful company. In South Korea, Tesco has defined research to establish that mothers prefer to look after their children rather than working, and so they have adapted their Tesco to ‘culture centres’, which gives the opportunity for mothers to bring their children in-store, and have access to the internet cafe.They also have the opportunity to take classes and learn new skills. This strategy shows the quality of how well Tesco have learnt to adapt to different cultures, as they know most of their customers will be mothers, thus giving more appeal to the target audience. Time would suggest that the business model adopted by Tesco, has been largely suc cessful. The first Tesco store in South Korea opened in 1999, and they have since gone on to open a further 457, with 59 opened in 2011/12 alone. They are presently the second largest retailer in all of South Korea, just behind the Shinsegae Group.These figures point to a highly successful campaign in Asia; proving that they were right to undertake a project based on reducing UA. (ref Wikipedia) Over the years, many different companies have been unsuccessful in trying to launch their various brands in certain countries. Most of these failures have been the result of poor product naming, but they still give an insight into the importance of research, and implementing strategies that conform with normal ways of life in those countries. For example, American Motors tried to market its car, the â€Å"Matador,† in Puerto Rico based on an image of strength and courage.However, in Puerto Rico the word, literally translated, means â€Å"killer. † The inappropriate name is link ed to the car’s lack of popularity because of the many hazardous roads in the country, and the correlation with death made by consumers. (ref www. worldpress. com) To conclude, after evaluating the strategies Tesco produce in both South Korea and the UK, it is clear that Tesco are an adaptable business that can appeal to different cultures. Without changing their strategies they wouldn’t be such a successful well-known international brand.

THEATER essays

THEATER essays How different cultures affected English Theater Theater unites the past and present in a unique cultural experience. Theatre continues to thrive and has become an important subject for study in schools and universities. Reaching back in time and across the world, this ranging new history draws on the latest scholarly research to describe and celebrate theatres greatest achievements over 4,500 years, from festival performances in Egypt to international multicultural theatre in the late twentieth century. English theatre has been changed by different cultures throughout the world. The Father of drama was Thesis of Athens, 535 BC, who created the first actor. The actor performed in intervals between the dancing of the chorus and conversing at times with the leader of the chorus. The tragedy was further developed when new myths became part of the performance, changing the nature of the chorus to a group appropriate to the individual story. Aeschylus added a second actor and a third actor was added by Sophocles, and the number of the chorus was fixed at fifteen. The chorus part was gradually reduced, and the dialogue of the actors became increasingly important. The word chorus meant dance or dancing ground, which was how dance evolved into the drama. Members of the chorus were characters in the play that commented on the action. They drew the audience into the play and reflected the audiences reactions. The Greek philosopher Aristotle, who observed the basic human tendancy to imitate, recognized the origins of Greek theatre in the dithyramb, a hymn sung and danced to honor the god Dionysus. This had evolved from earlier ecstatic dances by female celebrants of shamanism. A chorus of 50 men and related episodes from the gods life performed the dithyramb at annual festivals of Dionysus. The Greeks of Athens invented Western drama. Athenian playwrights used myths and heroic l...

Correlation Between Age and Memory Loss Essay Example

Correlation Between Age and Memory Loss Essay Example Correlation Between Age and Memory Loss Essay Correlation Between Age and Memory Loss Essay We have all wondered from time to time as to why the elderly seem to have a much greater falter-prone memory than the younger generations. From recently met people to the digits of their friends phone number, people seem to lag behind the youth in their memory capability as they grow older. One of the reasons behind this natural phenomena is due to an increase in brain cell loss which onsets around the age of twenty years old for most people. Unlike other things, Memory isnt a single cognitive process, and it isnt stored in a single area of the brain. Instead, it is classified by categories which span from short-term memory, to long-term memory, to factual memory, and onto motor-skill memory such as the knowledge of how to tie your shoes or drive a car. Memory loss tends to be categorized Into two categories which include Mild cognitive Impalement and Alchemies. When the Information which you begin to forget Is no longer travel, unimportant Information and your forgetfulness begins to eve consequences such as you forget an Important family members birthday or forget to pay your rent blank. Our memory loss would be considered to be beyond normal memory loss due to aging and may be diagnosed as mild cognitive impairment or MIMIC. On a more severe spectrum, when a persons memory loss becomes so severe that its capable of disrupting your work, hobbies, social activities, as well as your family relationships, a person may be experiencing the warning signs of Alchemists disease, another disorder that causes dementia, or a condition that mimics dementia. Often times, Limiters tends to be diagnosed people over the age of 65 but can also less-prevalently affect people younger as well. Latest statistics from the Alchemists association shows that In 2006, there were 22. 6 million sufferers world-wide and 1 In 85 people will be effected by this memory disorder by the year 2050. There are also several factors which can put an individual at greater risk for acquiring these memory disorders. Such factors include substances you come in contact with in your home and workplace. They include lead in drinking water or paint in older homes, mercury in paints, dyes and inks carbon monoxide leaking from home heaters and chemicals in pesticides and hobby materials. Alcohol and drug abuse has also been a major factor to inducing memory loss because excessive alcohol intake is toxic to brain cells, and illicit drugs such as marijuana, ecstasy, and cocaine block the function of neurotransmitters needed for memory. Also, 812 protects neurons, and some older persons develop an Inability to absorb It effectively. Memory loss treatments are mainly wealth the drug sectors but some non-drug alternatives can be used to help Meltzer a persons chance of acquiring such disorders. Memory loss is often caused due to inadequate supply of the required nutrients to our oral. I nose nutrients are Carlen o e ran y e t TN D I D TN 01000 Hell level of cholesterol restricts these nutrients from arriving at the brain. The chemicals present in the brain, known as neurotransmitters, are responsible for all the major odd functions, and these chemicals are dependent on the nutrients for proper functioning. Besides the well known dietary considerations for reducing the level of triglycerides and cholesterol, memory loss treatment depends mainly on its underlying cause. For instance, if memory loss is the result of depression, hormonal imbalance or any other disorder, then treating them would resolve the issue of memory loss as well. Besides these, the different brain exercises and self-help techniques also help in memory loss treatment.

Bio Ethical Principles in Psychiatric Treatment essays

Bio Ethical Principles in Psychiatric Treatment essays The medical professional in today's' global society has a great need of a firm grounding in the principles of Bioethics. . The vast expanse of ethical, spiritual and cultural beliefs from one country to another are inclusive of many variations of beliefs and principles that must be considered by the medical professional and indeed all that are employed within the medical field. Bio-ethical considerations have gravitated toward the use of "principle based approaches"[1] in resolving conflicts such as the situation. The concept of Non-Malfeficence is a derivative of traditional medical guidelines as ancient as the oath of the Doctor, the Medical professionals and caregivers are bogged down in an influx of ethical considerations as the world becomes more and more global. In light of the global society in which so many races, cultures, and ethics are meshed. The many faux pas possible in an eight hour day, due to differences in religion, medical and ethical beliefs, including beliefs based on disinformation and assumption is incomprehensible. The medical provider, in this case the psychiatrist, must consider the many aspects of that which influence the mother of this young boy in effectively denying to her son prescribed care for a diagnosed condition. The culture in China is one with a basis in the teaching of Confucius, further influenced by Taoism, Buddhism and the concept of ying and yang.[2] Philosophies of the culture in China as well as the religions and educational influences affect and shape the way the Chinese view healthcare and their beliefs are strongly tied to spiritual and ethical There are several approaches that the medical provider can take in effectively handling the situation. The first principle in bioethics is ...

APN Professional Development Plan Coursework Example | Topics and Well Written Essays - 1500 words

APN Professional Development Plan - Coursework Example The APN development plan involves the practising nurses in America. The development plan will be limited to the register nurses who have acquired masters’ degree. The development focuses on the APN who have completed three years practising as nurses. The development plan is aimed to make sure that APNs are more competed and provide sufficient care to the patients. The scope of APN practise composes of the integrative, technical abilities and cognitive of the registered and qualified nurse to practise safe and ethical acts, protocols, procedures and practical guidelines. In respect to education, an APN must have a post graduate education in the field of nursing or in nursing. For effectiveness in work place the advance practising nurse are equipped with clinical education, skills, scope and knowledge of practise in nursing. The APN clinical practise is based on scientific matters and applicable to secondary, primary and tertiary settings of health care practise. The role of the APN involves the peer education and dimension of patient, clinical leadership and mentorship (Stanley, 2010). In work APN applies an integration of theory, experience and practise together with autonomy in intervention and judgement. The post graduate education is indented to teach the nurse to apply different approaches to manage individual’s or group’s care, make decision and collaborate effectively with the client in order to get the best outcome. The APN has four areas of specialization which a nurse is required to undertake. The specialization includes nurse anaesthetists, nurse practitioners, nurse midwives and clinical nurse specialists. The nurse anaesthetists are registered in United States under the certified registered nurse or CRNAs. The nurse midwives are registered under the CNMs certified nurse midwives in United States. Each nurse is allowed to concentrate in a certain speciality in healthcare. The APN roles are regulated and controlled by a specific

Scenario Essay Example | Topics and Well Written Essays - 250 words

Scenario - Essay Example Furthermore, it forces one side to feel oppressed and correct, while the other feels guilt. Bringing up such tension simples show how racism is easy to rekindle and divisive even in its resolutions. In Ms. Williams’ place, I would present situations in foreign countries that show the devastating results not only of racism, but of counter-racism. More important than simply raising awareness about how racism has subsided nation-wide is to show the damage cause when groups do exactly what the students are doing—coming together as a race to stand against, rather than unite with, another. I would show immediately the most basic case, which is how anti-Semitism developed in Nazi Germany as a result to a pro-white movement. This would illustrate how too much pride in one’s own race can devastate. I would go on to give them harsh realities of genocide. One example is the Armenian genocide committed by Turkey, where European people suffered at the hands of another race. I would also mention that blacks in Africa are not only the oppressed, as they were in 20th Century America, but also have been violently oppressive. In the end, this would give the students a dose of reality rather than idealism. It would be a warning that conflicts have no victors, and that racism divides can divide into even smaller grudges which can end not only in hurt but in shocking loss of human life. This would be a lesson for all, and it would end with a reminder of why America gives us opportunity to live together—because our fathers and grandfathers managed to come to

Professional communication Essay Example | Topics and Well Written Essays - 500 words

Professional communication - Essay Example I want to emphasize that taking care of you, our customer, remains our highest priority and we thank you for your patience. If you have any further questions, or require assistance locating an Audi dealer, please visit audi.com or call us directly at 800-822-8987. First of all, as an important rule of business proposal letter writing serves the need to initially define who will be a reader of a letter, or, if it may have multiple recipients, what is its audience. In our particular case the letter is addressed to a concrete person, but there is every reason to believe that this letter was actually sent to many people, and thus is audience-oriented in nature. Its audience then is a group of people who have purchased a certain model of Audi, i.e. the existing clients of the company. Although the signature of the letter belongs to the Vice President of the company, the authorship of the letter is presented as if being from Audi company itself. In this situation such an authorship sets clear relations of seller-buyer between the sender of the letter and its recipients. Moreover, in this case the relations emerge on the ground of sellers responsibility before customers.

Musical Autobiography Essay Example | Topics and Well Written Essays - 750 words

Musical Autobiography - Essay Example It was one of the most famous songs at that time, which became the first international â€Å"local song†, familiar to all world cultures (The Center for American Music). â€Å"Old Folks at Home† is a song about the need for one’s family home, childhood memories, and the security of a family. No matter how far we go, we always miss â€Å"de old plantation and for de old folks at home† (Foster). This song has been performed by many singers, but I like best Paul Robeson’s interpretation from 1926. I first listened to it as an 8-year-old girl with my father, who is a big fan of Paul Robeson. This song used to accompany our family dinners, long car trips and outings. Today, when I feel sad and lonely, I play â€Å"Old Folks at Home† and I think about my family in Korea. This songs allows me to realize that even though I am so far away from my family, we are still close at heart. I know that I have a family that cares for me and a home where I will always be welcomed. Another song that reminds me of my childhood in Korea is â€Å"Candy†, performed by H.O.T, which was my favorite band when I was in primary school. H.O.T was the most popular boy band in Korea at that time and all my friends were their big fans. We all collected pictures and posters of H.O.T and we were spending a lot of time practicing the choreography of â€Å"Candy†. Although my musical tastes have changed with time, sometimes I like listening to â€Å"Candy† and thinking with nostalgia of the days when my biggest worry was lack of some poster of H.O.T. that my best friend had already had on the wall. This song reminds me of my pre-teen days, my first crash on Kang Ta – one of the members of the band, and the great moments I spent singing and dancing with my friends. I think that preadolescence is a very important stage in our lives, when we start to develop meaningful friendships, we have increased feelings of independence, and we

Bus Alice EEOC Board Essay Example | Topics and Well Written Essays - 250 words

Bus Alice EEOC Board - Essay Example The incident brought to a question whether the argument of making women separate themselves from men would work in the Park City Restaurant following the report of Ruby Tuesday of gross revenue of $1.25billion in the year 2013. Tighe observed this odd case and asked employers to avoid bringing the decision related to gender matters that is being applied by BFOQ. According to the author, the issue of gender discrimination is seen as uncouth barbaric behavior that should not be entertained in any society. He termed the act of gender discrimination as a ‘’Red Flag’’ (Allen Web). Allen gives reference using the press released by the EEOC’s San Francisco Regional Attorney William R. Tamayo, which talks negatively about cases related gender like that released by Ruby Tuesday’s about a job advertisement (Allen Web). Gender discrimination is a warning saga to most employers. Seattle Field Office Director by the name Nancy Sienko said that the company could have addressed any privacy concern that may come by providing separate accommodation entities for both male and females working in Park City. I am of the opinion that gender discrimination brings hatred amongst members of the society simply because others will see themselves better than others. All were against gender discrimination led by Ruby Tuesday. The Author went further not responding to a call for a comment about the incident that is now pending U.S. District Court after the District of Oregon attempts failed to meet the initial litigation through the EEOC conciliation process. The body i s now seeking financial damages on behalf of Herrera and

Strategic Plan Report Research Paper Example | Topics and Well Written Essays - 1000 words - 2

Strategic Plan Report - Research Paper Example ale organizations have strategic plans to guide them towards achieving their short term and long term goals, and the United States of America Department of Veterans Affairs is one of them. The Veterans Affairs department is the second largest, the largest being the Department of Defense. This department currently has an approximate number of 280, 000 employees (Longman, 2012). Founded over eighty years ago, this department has many roles and responsibilities, goals and objectives, all of them are centered towards the well being of USA veterans. This department, being a major one, operates with an approximate budget to the tune of $ 80 billion (Longman, 2012). The VA helps take care of veterans patient care, some basic family needs, compensation for those veterans injured during their line of duty, provision of education needs and provision of manageable home loans. The department also takes care of the veterans’ surgery and rehabilitative needs, funeral and bereavement provisions among others. The department’s short and long term goals demand a strategic plan. In the healthcare sector, the main short term goal is to be able to provide cheap affordable yet quality medication for the veterans. This definitely requires a very appropriate strategy, since the provision of healthcare is very vital to any country and its citizens well being (Panangala, 2011; Peter et al, 2013). The aforementioned operational activities form the short term goals of the department. In addition, it also aims at improving its service delivery, reducing the paper work and making disability claims easier for the veterans. The use of more specialized IT in the healthcare sector is also another goal of the organization (Longman, 2012). The department also has some long term goals, one of them being the goal to reduce and eventually get to zero cases of homelessness among the veterans. The department realizes that some of the veterans who spend their life fighting for their country, both

Musical Autobiography Essay Example | Topics and Well Written Essays - 750 words

Musical Autobiography - Essay Example It was one of the most famous songs at that time, which became the first international â€Å"local song†, familiar to all world cultures (The Center for American Music). â€Å"Old Folks at Home† is a song about the need for one’s family home, childhood memories, and the security of a family. No matter how far we go, we always miss â€Å"de old plantation and for de old folks at home† (Foster). This song has been performed by many singers, but I like best Paul Robeson’s interpretation from 1926. I first listened to it as an 8-year-old girl with my father, who is a big fan of Paul Robeson. This song used to accompany our family dinners, long car trips and outings. Today, when I feel sad and lonely, I play â€Å"Old Folks at Home† and I think about my family in Korea. This songs allows me to realize that even though I am so far away from my family, we are still close at heart. I know that I have a family that cares for me and a home where I will always be welcomed. Another song that reminds me of my childhood in Korea is â€Å"Candy†, performed by H.O.T, which was my favorite band when I was in primary school. H.O.T was the most popular boy band in Korea at that time and all my friends were their big fans. We all collected pictures and posters of H.O.T and we were spending a lot of time practicing the choreography of â€Å"Candy†. Although my musical tastes have changed with time, sometimes I like listening to â€Å"Candy† and thinking with nostalgia of the days when my biggest worry was lack of some poster of H.O.T. that my best friend had already had on the wall. This song reminds me of my pre-teen days, my first crash on Kang Ta – one of the members of the band, and the great moments I spent singing and dancing with my friends. I think that preadolescence is a very important stage in our lives, when we start to develop meaningful friendships, we have increased feelings of independence, and we

Strategic Plan Report Research Paper Example | Topics and Well Written Essays - 1000 words - 2

Strategic Plan Report - Research Paper Example ale organizations have strategic plans to guide them towards achieving their short term and long term goals, and the United States of America Department of Veterans Affairs is one of them. The Veterans Affairs department is the second largest, the largest being the Department of Defense. This department currently has an approximate number of 280, 000 employees (Longman, 2012). Founded over eighty years ago, this department has many roles and responsibilities, goals and objectives, all of them are centered towards the well being of USA veterans. This department, being a major one, operates with an approximate budget to the tune of $ 80 billion (Longman, 2012). The VA helps take care of veterans patient care, some basic family needs, compensation for those veterans injured during their line of duty, provision of education needs and provision of manageable home loans. The department also takes care of the veterans’ surgery and rehabilitative needs, funeral and bereavement provisions among others. The department’s short and long term goals demand a strategic plan. In the healthcare sector, the main short term goal is to be able to provide cheap affordable yet quality medication for the veterans. This definitely requires a very appropriate strategy, since the provision of healthcare is very vital to any country and its citizens well being (Panangala, 2011; Peter et al, 2013). The aforementioned operational activities form the short term goals of the department. In addition, it also aims at improving its service delivery, reducing the paper work and making disability claims easier for the veterans. The use of more specialized IT in the healthcare sector is also another goal of the organization (Longman, 2012). The department also has some long term goals, one of them being the goal to reduce and eventually get to zero cases of homelessness among the veterans. The department realizes that some of the veterans who spend their life fighting for their country, both

Mans Impact on the Environment Essay Example for Free

Mans Impact on the Environment Essay Pollution is the presence or introduction into the environment of a substance or thing that has harmful or poisonous effects. It is created mostly by human actions, but can also be a result of natural disasters. Pollution has a detrimental effect on every living organism in the environment, making it increasingly unsustainable for living organisms in the environment. to sustain life. Pollution harms the Earth’s environment and its inhabitants in many ways. The three main types of pollution are: Land Pollution, Air Pollution and Water Pollution. Read more: Bad Effects of Various Festivals on the Environment Land Pollution Land pollution is the degradation of Earths land surfaces often caused by human activities (industrial, commercial, domestic and agricultural) and their misuse of land resources. Land pollution is caused by the following:- †¢Chemical and nuclear plants †¢Industrial factories †¢Oil refineries †¢Human sewage †¢Oil †¢Mining †¢Littering †¢Overcrowded landfills †¢Deforestation †¢Construction debris †¢Non – biodegradable waste †¢Insecticides and Herbicides Chemical and Nuclear Plants Chemical and nuclear power plants produce waste materials. Some end up in landfills and other less safe storage facilities. Some leak, causing contamination of soil for hundreds of years before it is safe to grow crops on them again. Non – Biodegradable Waste Examples of these include: Mercury and Led. Harmful substances accumulate on the land and in turn become detrimental to the health of organisms not only on land, but animals in the air and in water. Insecticides and Biodegradable Most commonly used in the Agriculture Industry. These artificial methods of ridding plants and animals of pests and insects accumulate in organisms through the food chain which sometimes causes a death in the top consumers which further results in a destruction of the food chains and mutations.

The History Of The Electric Guitar Film Studies Essay

The History Of The Electric Guitar Film Studies Essay Contemporary music can be either loved or hated, listened with pleasure or suffered with a heavy teeth, praised or blamed. However, neither supporters nor opponents of modern jazz, rock and rap would deny that the queen of modern music electric guitar is an important invention of the 20th century. Thanks to the emergence of electric guitar, there appeared such styles rock and roll, hard rock, heavy metal, psychedelic rock, alternative, punk, grunge and hundreds of other types and styles, totally different, but united by one thing the sound of electric guitar. The electric guitar completely changed the world of contemporary music, and we do not know how it could look like, if in the far 1924 the pickup had not been invented. There appeared hundreds of new companies specializing on the production of electric guitars, such as the Music Man, Ibanez, Jackson, BS Rich; and all of them are based on the findings and ideas presented by George Bishampom, Paul Barth, Adolf Rickenbacker, Lloyd Loher, Les Paul, Leo Fender and Ted McCarthy. Precisely thanks to these people, the contemporary music is such as we know it. Electric guitar is a kind of guitar with the pickup that converts vibrations of metal strings into electric current oscillations. The signal from the pickups can be processed to produce various sound effects and then amplified for playback through the speakers. Some believe that the electric guitar is made of plastic or metal, but in fact it is usually made of wood. The most common materials are alder, ash, mahogany, maple. As the plates on the bar rosewood, ebony and maple are used. The most common are six-string electric guitars. Its better to start telling the history of the electric guitar invention, by saying that there are many styles of music, which are not even impossible without this instrument. In some directions and styles it plays a dominant role, we mean rock and roll and its derivatives up to the Heavy, as well as Doom / Death and Black Metal. Without guitars all of the above are impossible. Electric guitar is used in several other musical styles in varying degrees. In addition, the musical direction which has found electric guitar can exist without it. We are talking about the blues. In the early twentieth century, the acoustic guitar has become a full member of dance bands. Numerous American jazz and blues bands in the 1920s and 1930s used acoustic guitar, but it almost could not be heard, therefore, it was on the post of a rhythm instrument. It did not satisfy audience and musicians. Experiments on gaining derived sounds from the guitar began. Inventors, as usual, can to help. The first known experiment with amplification of guitar sound with the help of electricity is related to 1924 when Lloyd Loar (engineer and inventor who worked in the company of Gibson) invented the pickup, a fixed oscillation of the resonator box stringed instruments. However, his invention failed on the market. In 1931, George Beauchamp and Adolph Rickenbacker invented an electromagnetic pickup in which an electric pulse running through the winding of the magnet, created an electromagnetic field, which amplifies the signal from the vibrating strings. When their instrument appeared, it was immediately called  «frying pan », because firstly, the case was all-metal. Secondly, by its form the tool reminded the pan with a disproportionately long handle neck. But in the end it was the first viable and competitive electric guitar. The success of these first models prompted Gibson to create his (now legendary) model ES-150. The first electric Hawaiian-style guitar from the Ro-Pat-In (later Rickenbacker) appeared on the U.S. market in 1932. By the end of 1930 many experimenters have begun to experiment and build pickups in a more traditional looking Spanish guitars with hollow shells. But they met trouble in the form of resonance interference (feedback), distortion and other extraneous noise. In the end, that problem was solved with the help of double counter-winding, which extinguished unwanted signal. But first, musicians and engineers had tried to solve the problem differently: they put all sorts of rags and scraps of newspaper in the resonator box to get rid of unnecessary fluctuations and pickups. The most radical option was suggested by guitarist and engineer Les Paul he just made a deck for guitar monolithic. Unlike pans, however, the deck of Les Paul was made of wood (pine). And it was called The Log. For pickup Les Paul used the parts from the phone, and, ordinary piece of wood as the body. Due to the fact that the sound was amplified by the electronics, acoustic resonator was not needed anymore. When he first appeared in public his instrument looked like for something strange. Finally, to appease the public Les Paul attached body Spanish guitar to bars. Other engineers began to experiment with solid or nearly solid piece of wood. In 1940, Paul Bigsby and Leo Fender were doing that. By 1950, the company founded by Fender already produced a guitar named Esquire, followed by a Broadcaster, then Telecaster, and in 1954 the world saw the first Stratocaster. Since then, the electric guitar became massively produced and became an integral part of modern music. Electric guitar is the purest product of scientific and technological revolution. The guitar masters of the past were changing the sound of instrument, experimenting with its design and materials it is made of. Modern Torreses modify only the audio signal coming from the sensor to the amplifier. They deal with the frequency converter and chips, resulting in experimental sounds, that dont sound as guitar. Only the list of effects that can be achieved when playing the electric guitar, using the so-called gadgets, can take a couple of paragraphs. Since the sound of electric guitar does not depend on the shape of its body, the designers give it more and more bizarre shapes. It is true, that the most successful variants of the body of electric guitar are patented by manufacturers (electric guitar with the body in the form of a dovetail produces, for example, by Gibson). Besides Gibson the internationally known are such companies as Fender, BcRich, Ibanez. Computerization has not bypassed the electric guitar also. Today, there are some models of electric guitars, which are equipped with electronic device, which was made it possible to record the sound of string. The sound is recorded in the form of computer code that goes into digital devices, processing and reproducing sound. Due to such innovations, the guitar sound became especially impressive and simply magical. It is impossible not to be fond of modern jazz, blues, funk, rap, rock and other music when the musical world is ruled by electric guitar. As it was already mentioned, the appearance of the guitar influenced many genres and artists. Electric guitar is widely applied in such kinds of music as jazz, blues, rock, academic music and others. Electric guitar came to jazz in 1937 thanks to Eddie Durham, who (through the orchestra os Jimmy Lunsford) got to Count Basie. Basie, however, preferred to use him as a trombonist. The only guitar solo by Durham eight-tact piece, played on an electric National, tapped only in  «Time Out » (recorded August 9, 1937). Historical was partly restored on March 18, 1938, when a group of Eddie Durham and His Base Four appeared in the New York studio to record two discs for the label Commodore. George Barnes became the first electric blues man when on March 1, 1938 played in the studio first with Big Bill Broonzy, and then with Curtis Jones. In 1939, the electric guitar was taken up by the grandees of the Chicago Blues Big Bill and Tamp Red. Then Memphis Minnie recorded electric version of the song  «Me And My Cauffer », which brought the first big success. Charlie Christian, who gained fame in the years 1939-1942, but could not receive big glory (in 1923 died of tuberculosis), became the third most important star of early electric guitar (after Durham and McAuliffe). Jazz historians say that he became a key figure in the history of modern electric guitar, influencing the work of such masters as Eldon Shemblin, Merle Travis, Hank Thompson, Chet Atkins, Bill Black, Jimmy Bryant, Barney Kessel, Tal Farlow, Wes Montgomery. Simultaneously with the emergence of rock music, electric guitar became a key instrument for rock bands. It sounded on the records of many early rock musicians Elvis Presley, Bill Haley, but a revolutionary impact on the development of rock electric guitar playing techniques was contributed by Chuck Berry and Bo Diddley. Their solo parties and techniques for using the guitar sound in the context of the songs, experimenting with the sound had a major influence on subsequent rock music. In 1960, there appear a number of new discoveries in the use of electric guitars. The celebrated guitarist Jimi Hendrix radically altered views on the guitar sound, creating in every possible way new sounds, using a wide range of effects. First of all, there appeared the first effects pedal of distortion and fuzz, which first were used by garage rock group (Link Wray, The Sonics, The Kinks), and a little later by more popular artists (The Beatles, The Rolling Stones). By the end of the decade musicians begin experimenting with the use of Guitar Canceller in songs (The Velvet Underground), as well as more aggressive and dirty sound. The latter led to the appearance of the genre of hard rock in the 1970s, whose most prominent guitarists were Ritchie Blackmore, Jimmy Page. In 1980, with the development of punk rock and alternative rock, musicians started experimenting with finding new sounds of electric guitars. An important role was played by some groups of the late 70s, for example, Joy Division, whose guitarist Bernard Sumner created not just the rhythm or the solo parts in the traditional sense, but atmospheric soundscapes perceived on a subconscious level. Revolutionary role in the development of rock guitar in 1980s was played by Sonic Youth, whose guitarists Torston Moore and Lee Ranaldo, using non-traditional settings and playing techniques, feedbacks, all sorts of strange guitar effects, could create a unique sound, which became the basis for all subsequent evolution of rock. Such groups as The Jesus and Mary Chain, Big Black, The Jesus Lizard, Pixies, Nirvana used the work of Sonic Youth, creating the genre of noise rock. It gave the development to the subgenre shoegazing, in which the sound of electric guitars was the most distant from the usual standards. The songs of shoegazing groups impose a huge number of parties, which sometimes sounded like synthesizers, traditional guitar riffs on the back burner, and all together they created a very strange and revolutionary effect. Brian Eno called that sound pop music of the future. Leading groups of the genre are My Bloody Valentine (guitarists Kevin Shields and Debbie Googe), Slowdive, Ride, Pale Saints. At the same time in the 80 years, basing on the folk-rock the 60s a softer guitar sound appeared, it gave multiple parties Symphony effect when imposing. A huge role in the development of such a sound was played by Johnny Marr from The Smiths. Electric guitar was very popular among composers of classical music also. In the 1950-1960s, many composers of classical music began to use electric guitar in their compositions. Among these works Gruppen by Karlheinz Stockhausen (1955-1957), String Trio by Donald Erb (1966), The Possibility of a New Work for Electric Guitar by Morton Feldman (1966). Among the later works of this kind there are MASS by Leonard Bernstein (1971), Electric Counterpoint by Steve Reich (1987), Miserere by Arvo Pà ¤rt (1989-1992), Symphony à ¢Ã¢â‚¬Å¾- 4 by Lepo Sumer (1992) with electric guitar solo in the third part. In the 1980-1990-ies even more young composers began to write compositions for electric guitar. Among them there are Steven Mackey, Nick Didkovsky, Scott Johnson and Tim Brady. Experimental composers, such as Glenn Branca and Rhys Chethem have written several symphonic compositions for electric guitars, which sometimes required up to 100 guitars. Electric guitar made famous a lot of outstanding musicians. Jimi Hendrix, an American guitarist, singer-songwriter and record producer was one of them. He is considered to be the greatest electric guitarist in musical history and one of the most leading musicians of his period in different genres. The main his genres were psychedelic rock, hard rock, blues-rock, acid rock, funk-rock. A lot of his compositions and songs can be considered as vivid examples of outstanding, prominent performance of electric guitar. His album Electric Ladyland (1968) is commonly considered The Jimi Hendrix Experiences greatest achievement and focuses attention on his unbelievable abilities as singer, musician. One of the most interesting songs in the album is Gypsy Eyes that is based on the field holler. The song is about Jimis mother. The author had major issues with his mom abandoning him as a child. Jimi nearly romanticized her as being an excellent motherand he really wants to find out if she loves him. The genre of the song is: psychedelic rock, funk rock, blues-rock. This song is followed by complex and original structures. It is full of sizzling, aggressive guitar sound and can be understood as a slice of blues and psychedelic features. Gypsy Eyes start out with a sole bass drum beating, then a fast hammer on pulloff continuation, to bass note to a high melody. While listening, there appears a real magic, voodoo gypsy feel to it that draws the listener in. The song is based on a standard, ancient blues field holler, with Jimi Hendrix creating some great synergy between his vocal and the lead guitar riff. In fact, the song is loaded with a collection of riffs, and Hendrix neatly compiles them together in one song. Utilizing the recording studio as an instrument, Hendrixs overdubbing technique reaches an early peak here, as the multiple guitar parts swirl around each other in spectacular fashion. In addition, the flanging/phasing effects are also a part of the arrangement, and by proxy the song itself. Characterizing the song, there can be said that the song features guitar themes that float between left and right channels. Richard Middleton remarks that licks in rock music are often used all the way through a formula and variations technique and that the composition Gypsy Eyes is put together from variants of five stock ideasfamiliar from other recordings in the same style (Middleton, 1990). Drum lick A Drum lick B A complex of riffs on guitar and bass guitar A basic melodic falling pattern, using the notes of the pentatonic scale A characteristic guitar effecty, the attacked single note with long decay and glissando fall (Middleton, 1990). He concludes that the combination and variations of these formulae are many and highly imaginative. But the basic formulae are so simple that the recording could well have been worked out in performance (Middleton, 1990). Jimi Hendrix wrote very different music, for example in his composition Purple Haze from the album Are You Experienced (1966), is known for its use of the Hendrix chord (dominant 7 # 9) that is played as the first chord right after the introduction. Such chord structure was regularly used in jazz by such musicians as Horace Silver at the beginning of 1960s, but was not implemented in rock on a regular basis. The beginning of the composition is remarkable for its well-known use of the distinctive tritone interval; it was often used by jazz artists. It is sounded when Hendrix plays an E7 #9 (low to high: E, G#, D, G) on the guitar while the bass plays an E (and its octave);( Rooksby, 2002) such a dissonant interval was unusual in popular music of the time. The guitar solo is played through an Octavia, an effects pedal that increases notes by one octave. The effect was developed by Roger Mayer, an acoustical and electronics engineer, and Mayer claims he made it in cooperation with Jimi Hendrix (Octavia). A dubbed guitar part using the Octavia can also be noticed in the outro. concl Electric guitar is a very well known or may be, even the most famous musical instrument in the world. Without this musical instrument people could not appreciate the talent and creativity of great musicians of our time. Thanks to the emergence of electric guitars, rich sound processing, as well as analog and digital processors allowed to change the sound of classical guitar incredibly. The appearance of an entirely new electronic sound foreshadowed the emergence of great virtuosos of the music world. Such legends of rock music, and simply outstanding personalities like Jimmy Hendrix, Jimmy Page (Led Zeppelin), Jeff Beck, BB King, Keith Richards (Rolling Stones ) fairly occupy a special place in the hall of fame of the world cultural enrichments and deserve respect. Thanks to the emergence of electric guitar, there appeared such styles rock and roll, hard rock, heavy metal, psychedelic rock, alternative, punk, grunge and hundreds of other types and styles. The electric guitar complete ly changed the world of contemporary music, making it brighter and more interesting. The electric guitar has been the most popular musical instrument for more than a half of a century and its popularity seems to be immortal.

A Brief History Of The Internet :: essays research papers

A Brief History of the Internet Within our society there has been a revolution, one that rivals that of the Industrial Revolution. The Technological Revolution. At the head of this revolution is the Internet. A place full of information, adventure, and even for some, romance. In our society today everyone has heard of this technological wonder, and many use it on a daily basis, but for some the question still remains†¦ What is the Internet, and where did it come from?   Ã‚  Ã‚  Ã‚  Ã‚  Some thirty years ago, the RAND Corporation, American’s foremost Cold War think-tank, faced a strange strategic problem. How could the US authorities successfully communicate after a nuclear war? Post nuclear America would need a command-and-control network, linked from city to city, state-to-state, and base-to-base. But no matter how thoroughly that network was armored or protected, its switches and wiring would always be vulnerable to the impact of atomic bombs. A nuclear attack would reduce any conceivable network to tatters. And how would the network itself be commanded and controlled? Any central authority, any network central citadel, would be an obvious and immediate target for an enemy missile. RAND mulled over this grim puzzle in deep military secrecy, and arrived at a daring solution. The network would have no central authority. Furthermore, it would be designed from the beginning to operate while in tatters.   Ã‚  Ã‚  Ã‚  Ã‚  The principles were simple, the network itself would be assumed to be unreliable at all times (Krol 11). It would be designed from the get-go to transcend its own unreliability. All the nodes (computers hooked to the network) in the network would be equal in status to all other nodes, each node with its own authority to originate, pass, and receive messages. The messages themselves would be divided into packets, each packet separately addressed. Each packet would begin at some specified source node, and end at some other specified destination node, winding its way through the network on an individual basis (Krol 11). The particular route that the packet took would be unimportant. Only final results would count. Basically, the packet would be tossed like a hot potato from node to node, more or less in the direction of its destination, until it ended up in the proper place. If big pieces of the network had been blown away, that simply wouldn’t matter; the pac kets would still stay air born, lateralled wildly across the network by whatever node happened to survive. A Brief History Of The Internet :: essays research papers A Brief History of the Internet Within our society there has been a revolution, one that rivals that of the Industrial Revolution. The Technological Revolution. At the head of this revolution is the Internet. A place full of information, adventure, and even for some, romance. In our society today everyone has heard of this technological wonder, and many use it on a daily basis, but for some the question still remains†¦ What is the Internet, and where did it come from?   Ã‚  Ã‚  Ã‚  Ã‚  Some thirty years ago, the RAND Corporation, American’s foremost Cold War think-tank, faced a strange strategic problem. How could the US authorities successfully communicate after a nuclear war? Post nuclear America would need a command-and-control network, linked from city to city, state-to-state, and base-to-base. But no matter how thoroughly that network was armored or protected, its switches and wiring would always be vulnerable to the impact of atomic bombs. A nuclear attack would reduce any conceivable network to tatters. And how would the network itself be commanded and controlled? Any central authority, any network central citadel, would be an obvious and immediate target for an enemy missile. RAND mulled over this grim puzzle in deep military secrecy, and arrived at a daring solution. The network would have no central authority. Furthermore, it would be designed from the beginning to operate while in tatters.   Ã‚  Ã‚  Ã‚  Ã‚  The principles were simple, the network itself would be assumed to be unreliable at all times (Krol 11). It would be designed from the get-go to transcend its own unreliability. All the nodes (computers hooked to the network) in the network would be equal in status to all other nodes, each node with its own authority to originate, pass, and receive messages. The messages themselves would be divided into packets, each packet separately addressed. Each packet would begin at some specified source node, and end at some other specified destination node, winding its way through the network on an individual basis (Krol 11). The particular route that the packet took would be unimportant. Only final results would count. Basically, the packet would be tossed like a hot potato from node to node, more or less in the direction of its destination, until it ended up in the proper place. If big pieces of the network had been blown away, that simply wouldn’t matter; the pac kets would still stay air born, lateralled wildly across the network by whatever node happened to survive.

Hamlets Antic Disposition Essay -- Shakespeare Hamlet

Hamlet's Antic Disposition [See Hamlet, II.ii.159-185 in which Polonius proposes to use his daughter Ophelia as a bait for Hamlet, while Polonius and Claudius conceal themselves behind an arras; at which point Hamlet enters unexpectedly and is spoken to by Polonius] Everything that Hamlet here says is capable of an equivocal interpretation reflecting upon Polonius and Ophelia. "Fishmonger," as many commentators have noted, means a pander or procurer; "carrion" was a common expression at that time for "flesh" in the carnal sense; while the quibble in "conception" needs no explaining. And when I asked myself why Hamlet should suddenly call Polonius a bawd and his daughter a prostitute-for that is what it all amounts to-I could discover but one possible answer to my question, namely that "Fishmonger" and the rest follows immediately upon "loose my daughter to him." Nor was this the end of the matter. For what might Hamlet mean by his sarcastic advice to the father not to let the daughter "walke i'th Sunne," or by the reference to the sun breeding in the "carrion" exposed to it? Bearing in mind Hamlet's punning retort "I am too much in the 'son,'" in answer to Claudius's unctuous question at J.ii.64, And now my cousin Hamlet, and my son, How is it that the clouds still hang on you? - and recalling Falstaff's apostrophe to Prince Hal: "Shall the blessed sun of heaven prove a micher and eat blackberries? a question not to be asked. Shall the son of England prove a thief and take purses? a question to be asked," is it not obvious that Hamlet here means by "Sunne" the sun or son of Denmark, the heir apparent, in other words himself? A... ...n to spy upon him has a bearing much wider than his attitude towards Ophelia. Indeed, the manner in which it eases the general working of the plot is strong testimony in its favor. As we shall find, it constitutes the mainspring of the events that follow in acts II and III; it renders the nunnery scene playable and intelligible as never before; it adds all kinds of fresh light and shade to the play scene. In a word, its recovery means the restoration of a highly important piece of the dramatic structure. For the moment, however, let us confine our attention to the matter in hand; and see what it tells us about Hamlet's relations with the daughter of Polonius. Here its value is at once obvious, since it casts its light backward as well as forward and enables us for the first time to see these relations in proper perspective and as a connected whole.

Informative Speech Outline on Addiction to Prescription Drugs

Informative Speech – Topical Orientation General purpose: Addiction to prescription drugs Specific purpose: To inform my audience about the growing problem of prescription drug abuse, some common drugs that cause abuse, and their effects and some common treatments. Pattern: People living in today’s society must be aware about the dangers that prescription Drugs can cause them, as well as the people around them. Introduction: * Attention : Is it possible that you or someone you love is addicted to prescription drugs? An estimated 48 million people according to the National Institute on Drug Abuse, have used prescription drugs for nonmedical reasons in their lifetime. According to * Credibility: It was a big epidemic in my high school and surrounding schools. Ive lost relationships with people close to me due to their prescription drug addiction. * . Drug addiction is growing rapidly throughout the united states and its effecting all age ranges. * There needs to be more r estrictions placed because people think because the doctor is giving it to them, it is safe to abuse them * .Today im going to discuss what types of prescription drugs are being abused, how it effects your life and health, and possible ways to overcome the spread of the addiction. * Reason to listen: * . Ive come to realize that unfortunately everyone knows someone who is addicted to prescription drugs. * . * Preview: * Types of prescription drugs * The harms they cause * Ways to overcome the spread of addiction Body: A. . 1 .. The three different classes of prescription drugs a. . opioids- used to treat pain-oxycodone, vicodin, roxicet b. depressants-used to treat anxiety and sleep disorders- Xanax, Valium, Klonopin c. . stimulants- used to treat attention deficit disorders- Adderrall, ritalin 2. .. The harms that prescription drugs cause d. . opioids can cause drowsiness constipation and long term could cause severe respiratory depression which is†¦ or in highest doses, death . e. .anti depressants as well as anti anxiety they can cause sexual disfunction weight gain fatigue. with the use of these drugs it’s a chance you can be physically uncoordinated for the first few days until you build your tolerance. . .stimulants can cause enhanced brain activity increase and llertness in energy elevated blood pressure increase heart rate increase respiration and sleep deprivation†¦. Ultimately these three drugs possess the same long term affect when abused; high potential for physical dependence and addiction. 3. Ways for physiciaisn patients and pharamasists to all play a role in identidying and preventing prescription drug abuse. g. . physicians- ask about any and all drug abuse; screening for prescription drug use can be incorporated into routine medical visits.Take note of of rapid increases in the amount of medication needed. f. patients follow directions and be aware of potential interactions with other drugs. Don’t just change your dose without discussing with your doctor first. Never use another persons prescription. Transition: .. B. . Why is prescription drug addiction on the rise? 1. Why is prescription drug addiction on the rise a. Doctors don’t exactly know how many people are addicted to pain medication, but one of the reasons so many people are is the availability. b. Vastly more people have access to these medicines today than 15 or 20 years ago. † a. Responding to patients and pain advocacy groups, doctors may have become less restrictive in prescribing opioid pain pills. There has been a surge in prescriptions for opioids over the past decade — and the creation of millions of potential drug stashes in medicine cabinets across the country. b. Teen drug abuse with opioids is now second only to marijuana in popularity. Almost one in 10 high school seniors report taking hydrocodone (Vicodin) within the past year.Not by coincidence, many of their parents are taking it too: Vicodin and its generic form were the most-prescribed drug of any kind for much of this decade. Transition: .. C. . 2 . What are some ways that we can treat these prescribed drug addictions? h. .Some addictions, such as opioid addiction, can be treated with medications. i. . These pharmacological treatments counter the effects of the drug on the brain and behavior, and can be used to relieve withdrawal symptoms, help overcome drug cravings, or treat an overdose. a.Although a behavioral or pharmacological approach alone may be sufficient for treating some patients, research shows that a combined approach may be best. Conclusion: * Review. * . Types of prescription drugs * .. the harms that prescription drugs can cause * .. ways to overcome the spread of addiction * .. People living in today’s society must be aware about the dangers that prescription drugs can cause them, as well as the people around them. * Closure: Drug addiction is such a wide spread epidemic and all of the people with pote ntial are losing control of their lives by abusing these drugs.